DNASU Plasmid Repository • 480.965.2857 | Email

CHEK2 (Homo sapiens) in pMCSG19 (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CHEK2
Gene Name:  checkpoint kinase 2
Sequence             
Original Clone ID: NCI10395
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG19               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00358147

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1632nts         Open reading frame : 1 to 1632
Reference Sequence Alignment

ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAG
CCCCATGGCAGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGC
TCCTCTACCAGCACGATGCCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTG
AGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCT
GAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAG
GATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGC
TGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGC
AAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATA
GAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGC
CGTCCTTTGAATAACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAAGTTTTTGTC
TTTTTTGATCTGACTGTAGATGATCAGTCAGTTTATCCTAAGGCATTAAGAGATGAATAC
ATCATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCTTTCGAGAGG
AAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCTATTGGTTCA
GCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATTTTGAAAAAGCTA
AATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTATTATATTGTT
TTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAACGCCTGAAA
GAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGTACCTTCATGAA
AACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCTCAAGAAGAG
GACTGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAGACCTCTCTC
ATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTTTCTGTTGGG
ACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTTATCTGC
CTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAGGATCAGATC
ACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAGAAAGCTCTG
GACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACAGAAGAAGCC
TTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGATCTTCTGTCT
GAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACTAGTCGAAAG
CGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCTGTGTGTGCT
GCTGTGTTGTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19

pMCSG19 in advanced viewed

Synonyms: pMCSG-19
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV, His, TEV, NA; amp resistance; ligation independent cloning (LIC).
Comments: pMCSG7 derivative: in vivo TVMV cleavage of MBP
Size (bp): 6441
Parent Vector: None
Empty Vector: EvNO00084265
Properties: bacterial expression, improves solubility of insert, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 16497515
Title: An expression vector tailored for large-scale, high-throughput purification of recombinant proteins

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC Ligation independent cloning (LIC) site 204 235
bacterial origin ori ColE1-type bacterial origin of replication 4416 5098
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV protease cleavage site 286 306
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI coding sequence 2045 3004
selectable marker AmpR ampicillin resistance gene 5193 6053
tag His 2 C-terminal 6xHis tag 140 157
tag His 6xHis tag 268 285
tag MBP N-terminal MBP 337 1443
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CHEK2
Symbol Nomenclature : CHEK2
SYNONYM : CDS1; CHK2; HuCds1; LFS2; PP1425; RAD53; hCds1
Designation : CHK2 checkpoint homolog|cds1 homolog|checkpoint-like protein CHK2|serine/threonine-protein kinase Chk2
Full Nomenclature : checkpoint kinase 2
GENEID : 11200
Locus Tag : RP11-436C9.1
GI : 13278894
GenBank Accession : BC004207
HGNC : 16627
MIM : 604373
Vega : OTTHUMG00000151023
Target GenBank: BC004207

 

Reference Sequence Alignment

  

HsCD00358147        ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAG
NM_145862.2         ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAG
NM_007194.3         ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAG
NM_001005735.1      ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAG
                    ************************************************************

HsCD00358147        CCCCATGGCAGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGC
NM_145862.2         CCCCATGGCAGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGC
NM_007194.3         CCCCATGGCAGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGC
NM_001005735.1      CCCCATGGCAGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGC
                    ************************************************************

HsCD00358147        TCCTCTACCAGCACGATGCCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTG
NM_145862.2         TCCTCTACCAGCACGATGCCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTG
NM_007194.3         TCCTCTACCAGCACGATGCCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTG
NM_001005735.1      TCCTCTACCAGCACGATGCCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTG
                    ************************************************************

HsCD00358147        AGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCT
NM_145862.2         AGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCT
NM_007194.3         AGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCT
NM_001005735.1      AGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCT
                    ************************************************************

HsCD00358147        GAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAG
NM_145862.2         GAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAG
NM_007194.3         GAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAG
NM_001005735.1      GAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAG
                    ************************************************************

HsCD00358147        GATGGATTTGCCAATCTT------------------------------------------
NM_145862.2         GATGGATTTGCCAATCTT------------------------------------------
NM_007194.3         GATGGATTTGCCAATCTTG-----------------------------------------
NM_001005735.1      GATGGATTTGCCAATCTTGAGACAGAGTCTGGCCATGTTACCCAATCTGATCTTGAACTC
                    ******************                                          

HsCD00358147        ------------------------------------------------------------
NM_145862.2         ------------------------------------------------------------
NM_007194.3         ------------------------------------------------------------
NM_001005735.1      CTGCTGTCATCTGATCCTCCTGCCTCAGCCTCCCAAAGTGCTGGGATAAGAGGTGTGAGG
                                                                                

HsCD00358147        ---------------------------GAATGTGTGAATGACAACTACTGGTTTGGGAGG
NM_145862.2         ---------------------------GAATGTGTGAATGACAACTACTGGTTTGGGAGG
NM_007194.3         ----------------------------AATGTGTGAATGACAACTACTGGTTTGGGAGG
NM_001005735.1      CACCATCCCCGGCCAGTTTGCAGTCTAAAATGTGTGAATGACAACTACTGGTTTGGGAGG
                                                ********************************

HsCD00358147        GACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGA
NM_145862.2         GACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGA
NM_007194.3         GACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGA
NM_001005735.1      GACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGA
                    ************************************************************

HsCD00358147        ACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATT
NM_145862.2         ACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATT
NM_007194.3         ACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATT
NM_001005735.1      ACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATT
                    ************************************************************

HsCD00358147        GCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAA
NM_145862.2         GCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAA
NM_007194.3         GCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAA
NM_001005735.1      GCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAA
                    ************************************************************

HsCD00358147        GGAAAACGCCGTCCTTTGAATAACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAA
NM_145862.2         GGAAAACGCCGTCCTTTGAATAACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAA
NM_007194.3         GGAAAACGCCGTCCTTTGAATAACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAA
NM_001005735.1      GGAAAACGCCGTCCTTTGAATAACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAA
                    ************************************************************

HsCD00358147        GTTTTTGTCTTTTTTGATCTGACTGTAGATGATCAGTCAGTTTATCCTAAGGCATTAAGA
NM_145862.2         GTTTTTGTCTTTTTTGATCTGACTGTAGATGATCAGTCAGTTTATCCTAAGGCATTAAGA
NM_007194.3         GTTTTTGTCTTTTTTGATCTGACTGTAGATGATCAGTCAGTTTATCCTAAGGCATTAAGA
NM_001005735.1      GTTTTTGTCTTTTTTGATCTGACTGTAGATGATCAGTCAGTTTATCCTAAGGCATTAAGA
                    ************************************************************

HsCD00358147        GATGAATACATCATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCT
NM_145862.2         GATGAATACATCATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCT
NM_007194.3         GATGAATACATCATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCT
NM_001005735.1      GATGAATACATCATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCT
                    ************************************************************

HsCD00358147        TTCGAGAGGAAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCT
NM_145862.2         TTCGAGAGGAAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCT
NM_007194.3         TTCGAGAGGAAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCT
NM_001005735.1      TTCGAGAGGAAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCT
                    ************************************************************

HsCD00358147        ATTGGTTCAGCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATTTTG
NM_145862.2         ATTGGTTCAGCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATTTTG
NM_007194.3         ATTGGTTCAGCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATTTTG
NM_001005735.1      ATTGGTTCAGCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATTTTG
                    ************************************************************

HsCD00358147        AAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTAT
NM_145862.2         AAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTAT
NM_007194.3         AAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTAT
NM_001005735.1      AAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTAT
                    ************************************************************

HsCD00358147        TATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAA
NM_145862.2         TATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAA
NM_007194.3         TATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAA
NM_001005735.1      TATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAA
                    ************************************************************

HsCD00358147        CGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGTAC
NM_145862.2         CGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAG---
NM_007194.3         CGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGTAC
NM_001005735.1      CGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGTAC
                    *********************************************************   

HsCD00358147        CTTCATGAAAACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCT
NM_145862.2         ------------------------------------------------------------
NM_007194.3         CTTCATGAAAACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCT
NM_001005735.1      CTTCATGAAAACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCT
                                                                                

HsCD00358147        CAAGAAGAGGACTGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAG
NM_145862.2         ------------------------ATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAG
NM_007194.3         CAAGAAGAGGACTGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAG
NM_001005735.1      CAAGAAGAGGACTGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAG
                                            ************************************

HsCD00358147        ACCTCTCTCATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTT
NM_145862.2         ACCTCTCTCATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTT
NM_007194.3         ACCTCTCTCATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTT
NM_001005735.1      ACCTCTCTCATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTT
                    ************************************************************

HsCD00358147        TCTGTTGGGACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTT
NM_145862.2         TCTGTTGGGACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTT
NM_007194.3         TCTGTTGGGACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTT
NM_001005735.1      TCTGTTGGGACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTT
                    ************************************************************

HsCD00358147        TTTATCTGCCTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAG
NM_145862.2         TTTATCTGCCTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAG
NM_007194.3         TTTATCTGCCTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAG
NM_001005735.1      TTTATCTGCCTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAG
                    ************************************************************

HsCD00358147        GATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAG
NM_145862.2         GATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAG
NM_007194.3         GATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAG
NM_001005735.1      GATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAG
                    ************************************************************

HsCD00358147        AAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACA
NM_145862.2         AAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACA
NM_007194.3         AAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACA
NM_001005735.1      AAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACA
                    ************************************************************

HsCD00358147        GAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGAT
NM_145862.2         GAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGAT
NM_007194.3         GAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGAT
NM_001005735.1      GAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGAT
                    ************************************************************

HsCD00358147        CTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACT
NM_145862.2         CTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACT
NM_007194.3         CTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACT
NM_001005735.1      CTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACT
                    ************************************************************

HsCD00358147        AGTCGAAAGCGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCT
NM_145862.2         AGTCGAAAGCGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCT
NM_007194.3         AGTCGAAAGCGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCT
NM_001005735.1      AGTCGAAAGCGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCT
                    ************************************************************

HsCD00358147        GTGTGTGCTGCTGTGTTGTGA
NM_145862.2         GTGTGTGCTGCTGTGTTGTGA
NM_007194.3         GTGTGTGCTGCTGTGTTGTGA
NM_001005735.1      GTGTGTGCTGCTGTGTTGTGA
                    *********************

Pathways

NCI : ATM pathway
NCI : FOXM1 transcription factor network
NCI : PLK3 signaling events
NCI : p53 pathway
Panther : p53 pathway
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 566173
HIP Master Clone ID : 476491
Original Clone ID : NCI10395

Organism


TAX_ID : 9606
Species Specific ID: 11200

Genome

Chromosome : 22
Map Location : 22q12.1
Ensembl : ENSG00000183765

Reagents

Labome : CHK2-antibody