DNASU Plasmid Repository • 480.965.5697 | Email

CDC25A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDC25A
Gene Name:  cell division cycle 25A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117002.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003644

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1575nts         Open reading frame : 1 to 1575
Reference Sequence Alignment

ATGGAACTGGGCCCGGAGCCCCCGCACCGCCGCCGCCTGCTCTTCGCCTGCAGCCCCCCT
CCCGCGTCGCAGCCCGTCGTGAAGGCGCTATTTGGCGCTTCAGCCGCCGGGGGACTGTCG
CCTGTCACCAACCTGACCGTCACTATGGACCAGCTGCAGGGTCTGGGCAGTGATTATGAG
CAACCACTGGAGGTGAAGAACAACAGTAATCTGCAGAGAATGGGCTCCTCCGAGTCAACA
GATTCAGGTTTCTGTCTAGATTCTCCTGGGCCATTGGACAGTAAAGAAAACCTTGAAAAT
CCTATGAGAAGAATACATTCCCTACCTCAGAAGCTGTTGGGATGTAGTCCAGCTCTGAAG
AGGAGCCATTCTGATTCTCTTGACCATGACATCTTTCAGCTCATCGACCCAGATGAGAAC
AAGGAAAATGAAGCCTTTGAGTTTAAGAAGCCAGTAAGACCTGTATCTCGTGGCTGCCTG
CACTCTCATGGACTCCAGGAGGGTAAAGATCTCTTCACACAGAGGCAGAACTCTGCCCCA
GCTCGGATGCTTTCCTCAAATGAAAGAGATAGCAGTGAACCAGGGAATTTCATTCCTCTT
TTTACACCCCAGTCACCTGTGACAGCCACTTTGTCTGATGAGGATGATGGCTTCGTGGAC
CTTCTCGATGGAGAGAATCTGAAGAATGAGGAGGAGACCCCCTCGTGCATGGCAAGCCTC
TGGACAGCTCCTCTCGTCATGAGAACTACAAACCTTGACAACCGATGCAAGCTGTTTGAC
TCCCCTTCCCTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAA
GAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAA
GAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCT
TCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGAC
TTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATC
TCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTT
GTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTG
AACTTGCACATGGAAGAAGAGGTTGAAGACTTCTTATTGAAGAAGCCCATTGTACCTACT
GATGGCAAGCGTGTCATTGTTGTGTTTCACTGCGAGTTTTCTTCTGAGAGAGGTCCCCGC
ATGTGCCGGTATGTGAGAGAGAGAGATCGCCTGGGTAATGAATACCCCAAACTCCACTAC
CCTGAGCTGTATGTCCTGAAGGGGGGATACAAGGAGTTCTTTATGAAATGCCAGTCTTAC
TGTGAGCCCCCTAGCTACCGGCCCATGCACCACGAGGACTTTAAAGAAGACCTGAAGAAG
TTCCGCACCAAGAGCCGGACCTGGGCAGGGGAGAAGAGCAAGAGGGAGATGTACAGTCGT
CTGAAGAAGCTCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1948
Start on reference sequence 374
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDC25A
Symbol Nomenclature : CDC25A
SYNONYM : CDC25A2
Designation : CDC25 isoform A1-CAG|CDC25A2-CAG isoform|M-phase inducer phosphatase 1|dual specificity phosphatase CDC25A
Full Nomenclature : cell division cycle 25A
GENEID : 993
GI : 60655972
GenBank Accession : AY889759
HGNC : 1725
MIM : 116947
Vega : OTTHUMG00000133535
Target GenBank: BC007401

 

Reference Sequence Alignment

  

HsCD00003644      ATGGAACTGGGCCCGGAGCCCCCGCACCGCCGCCGCCTGCTCTTCGCCTGCAGCCCCCCT
NM_001789.2       ATGGAACTGGGCCCGGAGCCCCCGCACCGCCGCCGCCTGCTCTTCGCCTGCAGCCCCCCT
NM_201567.1       ATGGAACTGGGCCCGGAGCCCCCGCACCGCCGCCGCCTGCTCTTCGCCTGCAGCCCCCCT
                  ************************************************************

HsCD00003644      CCCGCGTCGCAGCCCGTCGTGAAGGCGCTATTTGGCGCTTCAGCCGCCGGGGGACTGTCG
NM_001789.2       CCCGCGTCGCAGCCCGTCGTGAAGGCGCTATTTGGCGCTTCAGCCGCCGGGGGACTGTCG
NM_201567.1       CCCGCGTCGCAGCCCGTCGTGAAGGCGCTATTTGGCGCTTCAGCCGCCGGGGGACTGTCG
                  ************************************************************

HsCD00003644      CCTGTCACCAACCTGACCGTCACTATGGACCAGCTGCAGGGTCTGGGCAGTGATTATGAG
NM_001789.2       CCTGTCACCAACCTGACCGTCACTATGGACCAGCTGCAGGGTCTGGGCAGTGATTATGAG
NM_201567.1       CCTGTCACCAACCTGACCGTCACTATGGACCAGCTGCAGGGTCTGGGCAGTGATTATGAG
                  ************************************************************

HsCD00003644      CAACCACTGGAGGTGAAGAACAACAGTAATCTGCAGAGAATGGGCTCCTCCGAGTCAACA
NM_001789.2       CAACCACTGGAGGTGAAGAACAACAGTAATCTGCAGAGAATGGGCTCCTCCGAGTCAACA
NM_201567.1       CAACCACTGGAGGTGAAGAACAACAGTAATCTGCAGAGAATGGGCTCCTCCGAGTCAACA
                  ************************************************************

HsCD00003644      GATTCAGGTTTCTGTCTAGATTCTCCTGGGCCATTGGACAGTAAAGAAAACCTTGAAAAT
NM_001789.2       GATTCAGGTTTCTGTCTAGATTCTCCTGGGCCATTGGACAGTAAAGAAAACCTTGAAAAT
NM_201567.1       GATTCAGGTTTCTGTCTAGATTCTCCTGGGCCATTGGACAGTAAAGAAAACCTTGAAAAT
                  ************************************************************

HsCD00003644      CCTATGAGAAGAATACATTCCCTACCTCAGAAGCTGTTGGGATGTAGTCCAGCTCTGAAG
NM_001789.2       CCTATGAGAAGAATACATTCCCTACCTCAGAAGCTGTTGGGATGTAGTCCAGCTCTGAAG
NM_201567.1       CCTATGAGAAGAATACATTCCCTACCTCAGAAGCTGTTGGGATGTAGTCCAGCTCTGAAG
                  ************************************************************

HsCD00003644      AGGAGCCATTCTGATTCTCTTGACCATGACATCTTTCAGCTCATCGACCCAGATGAGAAC
NM_001789.2       AGGAGCCATTCTGATTCTCTTGACCATGACATCTTTCAGCTCATCGACCCAGATGAGAAC
NM_201567.1       AGGAGCCATTCTGATTCTCTTGACCATGACATCTTTCAGCTCATCGACCCAGATGAGAAC
                  ************************************************************

HsCD00003644      AAGGAAAATGAAGCCTTTGAGTTTAAGAAGCCAGTAAGACCTGTATCTCGTGGCTGCCTG
NM_001789.2       AAGGAAAATGAAGCCTTTGAGTTTAAGAAGCCAGTAAGACCTGTATCTCGTGGCTGCCTG
NM_201567.1       AAGGAAAAT---------------------------------------------------
                  *********                                                   

HsCD00003644      CACTCTCATGGACTCCAGGAGGGTAAAGATCTCTTCACACAGAGGCAGAACTCTGCCCCA
NM_001789.2       CACTCTCATGGACTCCAGGAGGGTAAAGATCTCTTCACACAGAGGCAGAACTCTGCCCCA
NM_201567.1       ------------------------------------------------------------
                                                                              

HsCD00003644      GCTCGGATGCTTTCCTCAAATGAAAGAGATAGCAGTGAACCAGGGAATTTCATTCCTCTT
NM_001789.2       GCTCGGATGCTTTCCTCAAATGAAAGAGATAGCAGTGAACCAGGGAATTTCATTCCTCTT
NM_201567.1       ---------CTTTCCTCAAATGAAAGAGATAGCAGTGAACCAGGGAATTTCATTCCTCTT
                           ***************************************************

HsCD00003644      TTTACACCCCAGTCACCTGTGACAGCCACTTTGTCTGATGAGGATGATGGCTTCGTGGAC
NM_001789.2       TTTACACCCCAGTCACCTGTGACAGCCACTTTGTCTGATGAGGATGATGGCTTCGTGGAC
NM_201567.1       TTTACACCCCAGTCACCTGTGACAGCCACTTTGTCTGATGAGGATGATGGCTTCGTGGAC
                  ************************************************************

HsCD00003644      CTTCTCGATGGAGAGAATCTGAAGAATGAGGAGGAGACCCCCTCGTGCATGGCAAGCCTC
NM_001789.2       CTTCTCGATGGAGAGAATCTGAAGAATGAGGAGGAGACCCCCTCGTGCATGGCAAGCCTC
NM_201567.1       CTTCTCGATGGAGAGAATCTGAAGAATGAGGAGGAGACCCCCTCGTGCATGGCAAGCCTC
                  ************************************************************

HsCD00003644      TGGACAGCTCCTCTCGTCATGAGAACTACAAACCTTGACAACCGATGCAAGCTGTTTGAC
NM_001789.2       TGGACAGCTCCTCTCGTCATGAGAACTACAAACCTTGACAACCGATGCAAGCTGTTTGAC
NM_201567.1       TGGACAGCTCCTCTCGTCATGAGAACTACAAACCTTGACAACCGATGCAAGCTGTTTGAC
                  ************************************************************

HsCD00003644      TCCCCTTCCCTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAA
NM_001789.2       TCCCCTTCCCTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAA
NM_201567.1       TCCCCTTCCCTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAA
                  ************************************************************

HsCD00003644      GAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAA
NM_001789.2       GAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAA
NM_201567.1       GAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAA
                  ************************************************************

HsCD00003644      GAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCT
NM_001789.2       GAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCT
NM_201567.1       GAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCT
                  ************************************************************

HsCD00003644      TCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGAC
NM_001789.2       TCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGAC
NM_201567.1       TCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGAC
                  ************************************************************

HsCD00003644      TTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATC
NM_001789.2       TTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATC
NM_201567.1       TTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATC
                  ************************************************************

HsCD00003644      TCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTT
NM_001789.2       TCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTT
NM_201567.1       TCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTT
                  ************************************************************

HsCD00003644      GTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTG
NM_001789.2       GTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTG
NM_201567.1       GTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTG
                  ************************************************************

HsCD00003644      AACTTGCACATGGAAGAAGAGGTTGAAGACTTCTTATTGAAGAAGCCCATTGTACCTACT
NM_001789.2       AACTTGCACATGGAAGAAGAGGTTGAAGACTTCTTATTGAAGAAGCCCATTGTACCTACT
NM_201567.1       AACTTGCACATGGAAGAAGAGGTTGAAGACTTCTTATTGAAGAAGCCCATTGTACCTACT
                  ************************************************************

HsCD00003644      GATGGCAAGCGTGTCATTGTTGTGTTTCACTGCGAGTTTTCTTCTGAGAGAGGTCCCCGC
NM_001789.2       GATGGCAAGCGTGTCATTGTTGTGTTTCACTGCGAGTTTTCTTCTGAGAGAGGTCCCCGC
NM_201567.1       GATGGCAAGCGTGTCATTGTTGTGTTTCACTGCGAGTTTTCTTCTGAGAGAGGTCCCCGC
                  ************************************************************

HsCD00003644      ATGTGCCGGTATGTGAGAGAGAGAGATCGCCTGGGTAATGAATACCCCAAACTCCACTAC
NM_001789.2       ATGTGCCGGTATGTGAGAGAGAGAGATCGCCTGGGTAATGAATACCCCAAACTCCACTAC
NM_201567.1       ATGTGCCGGTATGTGAGAGAGAGAGATCGCCTGGGTAATGAATACCCCAAACTCCACTAC
                  ************************************************************

HsCD00003644      CCTGAGCTGTATGTCCTGAAGGGGGGATACAAGGAGTTCTTTATGAAATGCCAGTCTTAC
NM_001789.2       CCTGAGCTGTATGTCCTGAAGGGGGGATACAAGGAGTTCTTTATGAAATGCCAGTCTTAC
NM_201567.1       CCTGAGCTGTATGTCCTGAAGGGGGGATACAAGGAGTTCTTTATGAAATGCCAGTCTTAC
                  ************************************************************

HsCD00003644      TGTGAGCCCCCTAGCTACCGGCCCATGCACCACGAGGACTTTAAAGAAGACCTGAAGAAG
NM_001789.2       TGTGAGCCCCCTAGCTACCGGCCCATGCACCACGAGGACTTTAAAGAAGACCTGAAGAAG
NM_201567.1       TGTGAGCCCCCTAGCTACCGGCCCATGCACCACGAGGACTTTAAAGAAGACCTGAAGAAG
                  ************************************************************

HsCD00003644      TTCCGCACCAAGAGCCGGACCTGGGCAGGGGAGAAGAGCAAGAGGGAGATGTACAGTCGT
NM_001789.2       TTCCGCACCAAGAGCCGGACCTGGGCAGGGGAGAAGAGCAAGAGGGAGATGTACAGTCGT
NM_201567.1       TTCCGCACCAAGAGCCGGACCTGGGCAGGGGAGAAGAGCAAGAGGGAGATGTACAGTCGT
                  ************************************************************

HsCD00003644      CTGAAGAAGCTCTGA
NM_001789.2       CTGAAGAAGCTCTGA
NM_201567.1       CTGAAGAAGCTCTGA
                  ***************

Pathways

NCI : ATM pathway
NCI : ATR signaling pathway
NCI : E2F transcription factor network
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin B2 mediated events
Reactome : Cyclin E associated events during G1/S transition
Reactome : E2F mediated regulation of DNA replication
Reactome : E2F-enabled inhibition of pre-replication complex formation
Reactome : G0 and Early G1
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : G2/M Checkpoints
Reactome : G2/M Transition
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Polo-like kinase mediated events
Reactome : S Phase
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

SMART domain : RHOD : Rhodanese Homology Domain
UniProt : P30304
HPRD : 00305

Clone

Cloning Information : 117002
HIP Master Clone ID : 92848
Original Clone ID : FLH117002.01X

Organism


TAX_ID : 9606
Species Specific ID: 993

Genome

Chromosome : 3
Map Location : 3p21
Ensembl : ENSG00000164045

Reagents

Labome : CDC25A-antibody