DNASU Plasmid Repository • 480.965.5697 | Email

RUVBL2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RUVBL2
Gene Name:  RuvB-like AAA ATPase 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117028.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003678

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1392nts         Open reading frame : 1 to 1392
Reference Sequence Alignment

ATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAACAAGGATTGAG
CGAATCGGTGCCCACTCCCACATCCGGGGACTGGGGCTGGACGATGCCTTGGAGCCTCGG
CAGGCTTCGCAAGGCATGGTGGGTCAGCTGGCGGCACGGCGGGCGGCTGGCGTGGTGCTG
GAGATGATCCGGGAAGGGAAGATTGCCGGTCGGGCAGTCCTTATTGCTGGCCAGCCGGGC
ACGGGGAAGACGGCCATCGCCATGGGCATGGCGCAGGCCCTGGGCCCTGACACGCCATTC
ACAGCCATCGCCGGCAGTGAAATCTTCTCCCTGGAGATGAGCAAGACCGAGGCGCTGACG
CAGGCCTTCCGGCGGTCCATCGGCGTTCGCATCAAGGAGGAGACGGAGATCATCGAAGGG
GAGGTGGTGGAGATCCAGATTGATCGACCAGCAACAGGGACGGGCTCCAAGGTGGGCAAA
CTGACCCTCAAGACCACAGAGATGGAGACCATCTACGACCTGGGCACCAAGATGATTGAG
TCCCTGACCAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCGACGGGC
AAGATCTCCAAGCTGGGCCGCTCCTTCACACGCGCCCGCGACTACGACGCTATGGGCTCC
CAGACCAAGTTCGTGCAGTGCCCAGATGGGGAGCTCCAGAAACGCAAGGAGGTGGTGCAC
ACCGTGTCCCTGCACGAGATCGACGTCATCAACTCTCGCACCCAGGGCTTCCTGGCGCTC
TTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGTGAGCAGATCAATGCCAAGGTG
GCTGAGTGGCGCGAGGAGGGCAAGGCGGAGATCATCCCTGGAGTGCTGTTCATCGACGAG
GTCCACATGCTGGACATCGAGAGCTTCTCCTTCCTCAACCGGGCCCTGGAGAGTGACATG
GCGCCTGTCCTGATCATGGCCACCAACCGTGGCATCACGCGAATCCGGGGCACCAGCTAC
CAGAGCCCTCACGGCATCCCCATAGACCTGCTGGACCGGCTGCTTATCGTCTCCACCACC
CCCTACAGCGAGAAAGACACGAAGCAGATCCTCCGCATCCGGTGCGAGGAAGAAGATGTG
GAGATGAGTGAGGACGCCTACACGGTGCTGACCCGCATCGGGCTGGAGACGTCACTGCGC
TACGCCATCCAGCTCATCACAGCTGCCAGCTTGGTGTGCCGGAAACGCAAGGGTACAGAA
GTGCAGGTGGATGACATCAAGCGGGTCTACTCACTCTTCCTGGACGAGTCCCGCTCCACG
CAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAACTCAAAGGCGAGAACATG
GACACCTCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1414
Start on reference sequence 23
Mutations:
None
Discrepancy:
c1376a,T459N
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RUVBL2
Symbol Nomenclature : RUVBL2
SYNONYM : ECP51; INO80J; REPTIN; RVB2; TIH2; TIP48; TIP49B
Designation : 48 kDa TATA box-binding protein-interacting protein|48 kDa TBP-interacting protein|51 kDa erythrocyte cytosolic protein|ECP-51|INO80 complex subunit J|RuvB (E coli homolog)-like 2|TAP54-beta|TIP60-associated protein 54-beta|erythrocyte cytosolic protein, 51-KD|repressing pontin 52|reptin52 protein|ruvB-like 2
Full Nomenclature : RuvB-like AAA ATPase 2
GENEID : 10856
Locus Tag : CGI-46
GI : 60652922
GenBank Accession : AY892239
HGNC : 10475
MIM : 604788
Vega : OTTHUMG00000183333
Target GenBank: BC004531

 

Reference Sequence Alignment

  

HsCD00003678        ATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAACAAGGATTGAG
XM_005258426.1      ------------------------------------------------------------
NM_006666.1         ATGGCAACCGTTACAGCCACAACCAAAGTCCCGGAGATCCGTGATGTAACAAGGATTGAG
XM_005258428.1      ------------------------------------------------------------
XM_005258427.1      ------------------------------------------------------------
                                                                                

HsCD00003678        CGAATCGGTGCCCACTCCCACATCCGGGGACTGGGGCTGGACGATGCCTTGGAGCCTCGG
XM_005258426.1      ------------------------------------------ATGTGCGCCTCCCACCCA
NM_006666.1         CGAATCGGTGCCCACTCCCACATCCGGGGACTGGGGCTGGACGATGCCTTGGAGCCTCGG
XM_005258428.1      ------------------------------------------------------------
XM_005258427.1      ------------------------------------------ATGTGCGCCTCCCACCCA
                                                                                

HsCD00003678        CAGGCTTCGCAAGGCATGGTGGGTCAGCTGGCGGCACGGCGGGCGGCTGGCGTGGTGCTG
XM_005258426.1      CAGGCTTCGCAAGGCATGGTGGGTCAGCTGGCGGCACGGCGGGCGGCTGGCGTGGTGCTG
NM_006666.1         CAGGCTTCGCAAGGCATGGTGGGTCAGCTGGCGGCACGGCGGGCGGCTGGCGTGGTGCTG
XM_005258428.1      ---------------ATGGTGGGTCAGCTGGCGGCACGGCGGGCGGCTGGCGTGGTGCTG
XM_005258427.1      CAGGCTTCGCAAGGCATGGTGGGTCAGCTGGCGGCACGGCGGGCGGCTGGCGTGGTGCTG
                                   *********************************************

HsCD00003678        GAGATGATCCGGGAAGGGAAGATTGCCGGTCGGGCAGTCCTTATTGCTGGCCAGCCGGGC
XM_005258426.1      GAGATGATCCGGGAAGGGAAGATTGCCGGTCGGGCAGTCCTTATTGCTGGCCAGCCGGGC
NM_006666.1         GAGATGATCCGGGAAGGGAAGATTGCCGGTCGGGCAGTCCTTATTGCTGGCCAGCCGGGC
XM_005258428.1      GAGATGATCCGGGAAGGGAAGATTGCCGGTCGGGCAGTCCTTATTGCTGGCCAGCCGGGC
XM_005258427.1      GAGATGATCCGGGAAGGGAAGATTGCCGGTCGGGCAGTCCTTATTGCTGGCCAGCCGGGC
                    ************************************************************

HsCD00003678        ACGGGGAAGACGGCCATCGCCATGGGCATGGCGCAGGCCCTGGGCCCTGACACGCCATTC
XM_005258426.1      ACGGGGAAGACGGCCATCGCCATGGGCATGGCGCAGGCCCTGGGCCCTGACACGCCATTC
NM_006666.1         ACGGGGAAGACGGCCATCGCCATGGGCATGGCGCAGGCCCTGGGCCCTGACACGCCATTC
XM_005258428.1      ACGGGGAAGACGGCCATCGCCATGGGCATGGCGCAGGCCCTGGGCCCTGACACGCCATTC
XM_005258427.1      ACGGGGAAGACGGCCATCGCCATGGGCATGGCGCAGGCCCTGGGCCCTGACACGCCATTC
                    ************************************************************

HsCD00003678        ACAGCCATCGCCGGCAGTGAAATCTTCTCCCTGGAGATGAGCAAGACCGAGGCGCTGACG
XM_005258426.1      ACAGCCATCGCCGGCAGTGAAATCTTCTCCCTGGAGATGAGCAAGACCGAGGCGCTGACG
NM_006666.1         ACAGCCATCGCCGGCAGTGAAATCTTCTCCCTGGAGATGAGCAAGACCGAGGCGCTGACG
XM_005258428.1      ACAGCCATCGCCGGCAGTGAAATCTTCTCCCTGGAGATGAGCAAGACCGAGGCGCTGACG
XM_005258427.1      ACAGCCATCGCCGGCAGTGAAATCTTCTCCCTGGAGATGAGCAAGACCGAGGCGCTGACG
                    ************************************************************

HsCD00003678        CAGGCCTTCCGGCGGTCCATCGGCGTTCGCATCAAGGAGGAGACGGAGATCATCGAAGGG
XM_005258426.1      CAGGCCTTCCGGCGGTCCATCGGCGTTCGCATCAAGGAGGAGACGGAGATCATCGAAGGG
NM_006666.1         CAGGCCTTCCGGCGGTCCATCGGCGTTCGCATCAAGGAGGAGACGGAGATCATCGAAGGG
XM_005258428.1      CAGGCCTTCCGGCGGTCCATCGGCGTTCGCATCAAGGAGGAGACGGAGATCATCGAAGGG
XM_005258427.1      CAGGCCTTCCGGCGGTCCATCGGCGTTCGCATCAAGGAGGAGACGGAGATCATCGAAGGG
                    ************************************************************

HsCD00003678        GAGGTGGTGGAGATCCAGATTGATCGACCAGCAACAGGGACGGGCTCCAAGGTGGGCAAA
XM_005258426.1      GAGGTGGTGGAGATCCAGATTGATCGACCAGCAACAGGGACGGGCTCCAAGGTGGGCAAA
NM_006666.1         GAGGTGGTGGAGATCCAGATTGATCGACCAGCAACAGGGACGGGCTCCAAGGTGGGCAAA
XM_005258428.1      GAGGTGGTGGAGATCCAGATTGATCGACCAGCAACAGGGACGGGCTCCAAGGTGGGCAAA
XM_005258427.1      GAGGTGGTGGAGATCCAGATTGATCGACCAGCAACAGGGACGGGCTCCAAGGTGGGCAAA
                    ************************************************************

HsCD00003678        CTGACCCTCAAGACCACAGAGATGGAGACCATCTACGACCTGGGCACCAAGATGATTGAG
XM_005258426.1      CTGACCCTCAAGACCACAGAGATGGAGACCATCTACGACCTGGGCACCAAGATGATTGAG
NM_006666.1         CTGACCCTCAAGACCACAGAGATGGAGACCATCTACGACCTGGGCACCAAGATGATTGAG
XM_005258428.1      CTGACCCTCAAGACCACAGAGATGGAGACCATCTACGACCTGGGCACCAAGATGATTGAG
XM_005258427.1      CTGACCCTCAAGACCACAGAGATGGAGACCATCTACGACCTGGGCACCAAGATGATTGAG
                    ************************************************************

HsCD00003678        TCCCTGACCAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCGACGGGC
XM_005258426.1      TCCCTGACCAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCGACGGGC
NM_006666.1         TCCCTGACCAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCGACGGGC
XM_005258428.1      TCCCTGACCAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCGACGGGC
XM_005258427.1      TCCCTGACCAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCGACGGGC
                    ************************************************************

HsCD00003678        AAGATCTCCAAGCTGGGCCGCTCCTTCACACGCGCCCGCGACTACGACGCTATGGGCTCC
XM_005258426.1      AAGATCTCCAAGCTGGGCCGCTCCTTCACACGCGCCCGCGACTACGACGCTATGGGCTCC
NM_006666.1         AAGATCTCCAAGCTGGGCCGCTCCTTCACACGCGCCCGCGACTACGACGCTATGGGCTCC
XM_005258428.1      AAGATCTCCAAGCTGGGCCGCTCCTTCACACGCGCCCGCGACTACGACGCTATGGGCTCC
XM_005258427.1      AAGATCTCCAAGCTGGGCCGCTCCTTCACACGCGCCCGCGACTACGACGCTATGGGCTCC
                    ************************************************************

HsCD00003678        CAGACCAAGTTCGTGCAGTGCCCAGATGGGGAGCTCCAGAAACGCAAGGAGGTGGTGCAC
XM_005258426.1      CAGACCAAGTTCGTGCAGTGCCCAGATGGGGAGCTCCAGAAACGCAAGGAGGTGGTGCAC
NM_006666.1         CAGACCAAGTTCGTGCAGTGCCCAGATGGGGAGCTCCAGAAACGCAAGGAGGTGGTGCAC
XM_005258428.1      CAGACCAAGTTCGTGCAGTGCCCAGATGGGGAGCTCCAGAAACGCAAGGAGGTGGTGCAC
XM_005258427.1      CAGACCAAGTTCGTGCAGTGCCCAGATGGGGAGCTCCAGAAACGCAAGGAGGTGGTGCAC
                    ************************************************************

HsCD00003678        ACCGTGTCCCTGCACGAGATCGACGTCATCAACTCTCGCACCCAGGGCTTCCTGGCGCTC
XM_005258426.1      ACCGTGTCCCTGCACGAGATCGACGTCATCAACTCTCGCACCCAGGGCTTCCTGGCGCTC
NM_006666.1         ACCGTGTCCCTGCACGAGATCGACGTCATCAACTCTCGCACCCAGGGCTTCCTGGCGCTC
XM_005258428.1      ACCGTGTCCCTGCACGAGATCGACGTCATCAACTCTCGCACCCAGGGCTTCCTGGCGCTC
XM_005258427.1      ACCGTGTCCCTGCACGAGATCGACGTCATCAACTCTCGCACCCAGGGCTTCCTGGCGCTC
                    ************************************************************

HsCD00003678        TTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGTGAGCAGATCAATGCCAAGGTG
XM_005258426.1      TTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGTGAGCAGATCAATGCCAAGGTG
NM_006666.1         TTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGTGAGCAGATCAATGCCAAGGTG
XM_005258428.1      TTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGTGAGCAGATCAATGCCAAGGTG
XM_005258427.1      TTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGTGAGCAGATCAATGCCAAGGTG
                    ************************************************************

HsCD00003678        GCTGAGTGGCGCGAGGAGGGCAAGGCGGAGATCATCCCTGGAGTGCTGTTCATCGACGAG
XM_005258426.1      GCTGAGTGGCGCGAGGAGGGCAAGGCGGAGATCATCCCTGGAGTGCTGTTCATCGACGAG
NM_006666.1         GCTGAGTGGCGCGAGGAGGGCAAGGCGGAGATCATCCCTGGAGTGCTGTTCATCGACGAG
XM_005258428.1      GCTGAGTGGCGCGAGGAGGGCAAGGCGGAGATCATCCCTGGAGTGCTGTTCATCGACGAG
XM_005258427.1      GCTGAGTGGCGCGAGGAGGGCAAGGCGGAGATCATCCCTGGAGTGCTGTTCATCGACGAG
                    ************************************************************

HsCD00003678        GTCCACATGCTGGACATCGAGAGCTTCTCCTTCCTCAACCGGGCCCTGGAGAGTGACATG
XM_005258426.1      GTCCACATGCTGGACATCGAGAGCTTCTCCTTCCTCAACCGGGCCCTGGAGAGTGACATG
NM_006666.1         GTCCACATGCTGGACATCGAGAGCTTCTCCTTCCTCAACCGGGCCCTGGAGAGTGACATG
XM_005258428.1      GTCCACATGCTGGACATCGAGAGCTTCTCCTTCCTCAACCGGGCCCTGGAGAGTGACATG
XM_005258427.1      GTCCACATGCTGGACATCGAGAGCTTCTCCTTCCTCAACCGGGCCCTGGAGAGTGACATG
                    ************************************************************

HsCD00003678        GCGCCTGTCCTGATCATGGCCACCAACCGTGGCATCACGCGAATCCGGGGCACCAGCTAC
XM_005258426.1      GCGCCTGTCCTGATCATGGCCACCAACCGTGGCATCACGCGAATCCGGGGCACCAGCTAC
NM_006666.1         GCGCCTGTCCTGATCATGGCCACCAACCGTGGCATCACGCGAATCCGGGGCACCAGCTAC
XM_005258428.1      GCGCCTGTCCTGATCATGGCCACCAACCGTGGCATCACGCGAATCCGGGGCACCAGCTAC
XM_005258427.1      GCGCCTGTCCTGATCATGGCCACCAACCGTGGCATCACGCGAATCCGGGGCACCAGCTAC
                    ************************************************************

HsCD00003678        CAGAGCCCTCACGGCATCCCCATAGACCTGCTGGACCGGCTGCTTATCGTCTCCACCACC
XM_005258426.1      CAGAGCCCTCACGGCATCCCCATAGACCTGCTGGACCGGCTGCTTATCGTCTCCACCACC
NM_006666.1         CAGAGCCCTCACGGCATCCCCATAGACCTGCTGGACCGGCTGCTTATCGTCTCCACCACC
XM_005258428.1      CAGAGCCCTCACGGCATCCCCATAGACCTGCTGGACCGGCTGCTTATCGTCTCCACCACC
XM_005258427.1      CAGAGCCCTCACGGCATCCCCATAGACCTGCTGGACCGGCTGCTTATCGTCTCCACCACC
                    ************************************************************

HsCD00003678        CCCTACAGCGAGAAAGACACGAAGCAGATCCTCCGCATCCGGTGCGAGGAAGAAGATGTG
XM_005258426.1      CCCTACAGCGAGAAAGACACGAAGCAGATCCTCCGCATCCGGTGCGAGGAAGAAGATGTG
NM_006666.1         CCCTACAGCGAGAAAGACACGAAGCAGATCCTCCGCATCCGGTGCGAGGAAGAAGATGTG
XM_005258428.1      CCCTACAGCGAGAAAGACACGAAGCAGATCCTCCGCATCCGGTGCGAGGAAGAAGATGTG
XM_005258427.1      CCCTACAGCGAGAAAGACACGAAGCAGATCCTCCGCATCCGGTGCGAGGAAGAAGATGTG
                    ************************************************************

HsCD00003678        GAGATGAGTGAGGACGCCTACACGGTGCTGACCCGCATCGGGCTGGAGACGTCACTGCGC
XM_005258426.1      GAGATGAGTGAGGACGCCTACACGGTGCTGACCCGCATCGGGCTGGAGACGTCACTGCGC
NM_006666.1         GAGATGAGTGAGGACGCCTACACGGTGCTGACCCGCATCGGGCTGGAGACGTCACTGCGC
XM_005258428.1      GAGATGAGTGAGGACGCCTACACGGTGCTGACCCGCATCGGGCTGGAGACGTCACTGCGC
XM_005258427.1      GAGATGAGTGAGGACGCCTACACGGTGCTGACCCGCATCGGGCTGGAGACGTCACTGCGC
                    ************************************************************

HsCD00003678        TACGCCATCCAGCTCATCACAGCTGCCAGCTTGGTGTGCCGGAAACGCAAGGGTACAGAA
XM_005258426.1      TACGCCATCCAGCTCATCACAGCTGCCAGCTTGGTGTGCCGGAAACGCAAGGGTACAGAA
NM_006666.1         TACGCCATCCAGCTCATCACAGCTGCCAGCTTGGTGTGCCGGAAACGCAAGGGTACAGAA
XM_005258428.1      TACGCCATCCAGCTCATCACAGCTGCCAGCTTGGTGTGCCGGAAACGCAAGGGTACAGAA
XM_005258427.1      TACGCCATCCAGCTCATCACAGCTGCCAGCTTGGTGTGCCGGAAACGCAAGGGTACAGAA
                    ************************************************************

HsCD00003678        GTGCAGGTGGATGACATCAAGCGGGTCTACTCACTCTTCCTGGACGAGTCCCGCTCCACG
XM_005258426.1      GTGCAGGTGGATGACATCAAGCGGGTCTACTCACTCTTCCTGGACGAGTCCCGCTCCACG
NM_006666.1         GTGCAGGTGGATGACATCAAGCGGGTCTACTCACTCTTCCTGGACGAGTCCCGCTCCACG
XM_005258428.1      GTGCAGGTGGATGACATCAAGCGGGTCTACTCACTCTTCCTGGACGAGTCCCGCTCCACG
XM_005258427.1      GTGCAGGTGGATGACATCAAGCGGGTCTACTCACTCTTCCTGGACGAGTCCCGCTCCACG
                    ************************************************************

HsCD00003678        CAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAACTCAAAGGCGAGAACATG
XM_005258426.1      CAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAACTCAAAGGCGAGACCATG
NM_006666.1         CAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAACTCAAAGGCGAGACCATG
XM_005258428.1      CAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAACTCAAAGGCGAGACCATG
XM_005258427.1      CAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAACTCAAAGGCGAGACCATG
                    *******************************************************.****

HsCD00003678        GACACCTCCTTG
XM_005258426.1      GACACCTCCTGA
NM_006666.1         GACACCTCCTGA
XM_005258428.1      GACACCTCCTGA
XM_005258427.1      GACACCTCCTGA
                    ********** .

Pathways

NCI : ATF-2 transcription factor network
NCI : C-MYC pathway
NCI : Integrin-linked kinase signaling
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Cell Cycle
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : Chromosome Maintenance
Reactome : Extension of Telomeres
Reactome : HATs acetylate histones
Reactome : Telomere Extension By Telomerase
Reactome : Telomere Maintenance

Clone

Cloning Information : 117028
HIP Master Clone ID : 92874
Original Clone ID : FLH117028.01L

Organism


TAX_ID : 9606
Species Specific ID: 10856

Genome

Chromosome : 19
Map Location : 19q13.3
Ensembl : ENSG00000183207

Reagents

Labome : RUVBL2-antibody