DNASU Plasmid Repository • 480.965.5697 | Email

NRG1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NRG1
Gene Name:  neuregulin 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014040.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003684

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 891nts         Open reading frame : 1 to 891
Reference Sequence Alignment

ATGGAGATTTATTCCCCAGACATGTCTGAGGTCGCCGCCGAGAGGTCCTCCAGCCCCTCC
ACTCAGCTGAGTGCAGACCCATCTCTTGATGGGCTTCCGGCAGCAGAAGACATGCCAGAG
CCCCAGACTGAAGATGGGAGAACCCCTGGACTCGTGGGCCTGGCCGTGCCCTGCTGTGCG
TGCCTAGAAGCTGAGCGCCTGAGAGGTTGCCTCAACTCAGAGAAAATCTGCATTGTCCCC
ATCCTGGCTTGCCTGGTCAGCCTCTGCCTCTGCATCGCCGGCCTCAAGTGGGTATTTGTG
GACAAGATCTTTGAATATGACTCTCCTACTCACCTTGACCCTGGGGGGTTAGGCCAGGAC
CCTATTATTTCTCTGGACGCAACTGCTGCCTCAGCTCTGTGGGTGTCGTCTGAGGCATAC
ACTTCACCTGTCTCTAGGGCTCAATCTGAAAGTGAGGTTCAAGTTACAGTGCAAGGTGAC
AAGGCTGTTGTCTCCTTTGAACCATCAGCGGCACCGACACCGAAGAATCGTATTTTTGCC
TTTTCTTTCTTGCCGTCCACTGCGCCATCCTTCCCTTCACCCACCCGGAACCCTGAGGTG
AGAACGCCCAAGTCAGCAACTCAGCCACAAACAACAGAAACTAATCTCCAAACTGCTCCT
AAACTTTCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
ATGGCCAGCTTCTACAGTACGTCCACTCCCTTTCTGTCTCTGCCTGAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1543
Start on reference sequence 653
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NRG1
Symbol Nomenclature : NRG1
SYNONYM : ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; NDF; SMDF
Designation : MSTP131|glial growth factor|heregulin, alpha (45kD, ERBB2 p185-activator)|neu differentiation factor|neuregulin 1 type IV beta 1a|neuregulin 1 type IV beta 3|pro-NRG1|pro-neuregulin-1, membrane-bound isoform|sensory and motor neuron derived factor
Full Nomenclature : neuregulin 1
GENEID : 3084
GI : 60652930
GenBank Accession : AY892243
HGNC : 7997
MIM : 142445
Vega : OTTHUMG00000163918
Target GenBank: BC007675

 

Reference Sequence Alignment

  

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      ATGGAGATTTATTCCCCAGACATGTCTGAGGTCGCCGCCGAGAGGTCCTCCAGCCCCTCC
NM_001160001.1      ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      ATGGAGATTTATTCCCCAGACATGTCTGAGGTCGCCGCCGAGAGGTCCTCCAGCCCCTCC
NM_013956.3         ------------------------------------------------------------
NM_001159995.1      ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_013957.3         ------------------------------------------------------------
XM_005273485.1      ATGGAGATTTATTCCCCAGACATGTCTGAGGTCGCCGCCGAGAGGTCCTCCAGCCCCTCC
NM_001159999.1      ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        -------------------------------------------------------ATGGA
XM_005273487.1      ACTCAGCTGAGTGCAGACCCATCTCTTGATGGGCTTCCGGCAGCAGAAGACATGCCAGAG
NM_001160001.1      ------------------------------------------------------------
NM_013962.2         ----------ATGAGATGGCGACGCGCCCCGCGCCGCTCCGGGCGTCCCGGCCCCCGGGC
XM_005273486.1      ACTCAGCTGAGTGCAGACCCATCTCTTGATGGGCTTCCGGCAGCAGAAGACATGCCAGAG
NM_013956.3         -------------ATGTCCGAGCGCAAAGAAGGCAGAGGCAAAGGGAAGGGCAAGAAGAA
NM_001159995.1      ------------------------------------------------------------
NM_013959.3         -------------------------------------------------------ATGGA
NM_013957.3         -------------ATGTCCGAGCGCAAAGAAGGCAGAGGCAAAGGGAAGGGCAAGAAGAA
XM_005273485.1      ACTCAGCTGAGTGCAGACCCATCTCTTGATGGGCTTCCGGCAGCAGAAGACATGCCAGAG
NM_001159999.1      ------------------------------------------------------------
NM_001160004.1      -------------ATGTCCGAGCGCAAAGAAGGCAGAGGCAAAGGGAAGGGCAAGAAGAA
NM_001160008.1      -------------ATGTCCGAGCGCAAAGAAGGCAGAGGCAAAGGGAAGGGCAAGAAGAA
                                                                                

HsCD00003684        GATTTATTCCCCAGACATGTCTGAGGTCGCCGCCGAGAGGTCCTCCAGCCCCTCCACTCA
XM_005273487.1      CCCCAGACTGAAGATGGGAGAACCCCTGGACTCGTGGGCCTGGCCGTGCCCTGCTGTGCG
NM_001160001.1      ----------------ATGGGGAAAGGACGCGCGGGCCGAGTTGGCACCACAGCCTTGCC
NM_013962.2         CCAGCGCCCCGGCTCCGCCGCCCGCTCGTCGCCGCCGCTGCCGCTGCTGCCACTACTGCT
XM_005273486.1      CCCCAGACTGAAGATGGGAGAACCCCTGGACTCGTGGGCCTGGCCGTGCCCTGCTGTGCG
NM_013956.3         GGAGCGAGGCTCCGGCAAGAAGCCGGAGTCCGCGGCGGGCAGCCAGAGCCCAGCCTTGCC
NM_001159995.1      ----------------ATGGGGAAAGGACGCGCGGGCCGAGTTGGCACCACAGCCTTGCC
NM_013959.3         GATTTATTCCCCAGACATGTCTGAGGTCGCCGCCGAGAGGTCCTCCAGCCCCTCCACTCA
NM_013957.3         GGAGCGAGGCTCCGGCAAGAAGCCGGAGTCCGCGGCGGGCAGCCAGAGCCCAGCCTTGCC
XM_005273485.1      CCCCAGACTGAAGATGGGAGAACCCCTGGACTCGTGGGCCTGGCCGTGCCCTGCTGTGCG
NM_001159999.1      ----------------ATGGGGAAAGGACGCGCGGGCCGAGTTGGCACCACAGCCTTGCC
NM_001160004.1      GGAGCGAGGCTCCGGCAAGAAGCCGGAGTCCGCGGCGGGCAGCCAGAGCCCAGCCTTGCC
NM_001160008.1      GGAGCGAGGCTCCGGCAAGAAGCCGGAGTCCGCGGCGGGCAGCCAGAGCCCAGCCTTGCC
                                    .               *                .*       * 

HsCD00003684        GCTGAGTGCAGACCCATCTCTTGATGGGCTTCCGGCAGCAGAAGACATGCCAGAGCCCCA
XM_005273487.1      TGCCTAGAAGCTGAGCGCCTGAGAGGTTGCCTCAACTCAGAGAAAATCTGCATTGTCCCC
NM_001160001.1      TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
NM_013962.2         GCTGCTGGGGACCGCGGCCCTGGCGCCGGGGGCGGCGGCCGGCAACGAGGCGGCTCCCGC
XM_005273486.1      TGCCTAGAAGCTGAGCGCCTGAGAGGTTGCCTCAACTCAGAGAAAATCTGCATTGTCCCC
NM_013956.3         TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
NM_001159995.1      TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
NM_013959.3         GCTGAGTGCAGACCCATCTCTTGATGGGCTTCCGGCAGCAGAAGACATGCCAGAGCCCCA
NM_013957.3         TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
XM_005273485.1      TGCCTAGAAGCTGAGCGCCTGAGAGGTTGCCTCAACTCAGAGAAAATCTGCATTGTCCCC
NM_001159999.1      TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
NM_001160004.1      TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
NM_001160008.1      TCCCCGATTGAAAGAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCG
                             .            .         *..*  . ..  ..     .        

HsCD00003684        GACTG-------------------------------------------------------
XM_005273487.1      ATCCTGGCTTGCCTGGTCAGCCTCTGCCTCTGCATCGCCGGCCTCAAGTGGGTATTTGTG
NM_001160001.1      GTGTG------------------------------------------------------A
NM_013962.2         GGGGG-------------------------------------------------------
XM_005273486.1      ATCCTGGCTTGCCTGGTCAGCCTCTGCCTCTGCATCGCCGGCCTCAAGTGGGTATTTGTG
NM_013956.3         GTGTG------------------------------------------------------A
NM_001159995.1      GTGTG------------------------------------------------------A
NM_013959.3         GACTG-------------------------------------------------------
NM_013957.3         GTGTG------------------------------------------------------A
XM_005273485.1      ATCCTGGCTTGCCTGGTCAGCCTCTGCCTCTGCATCGCCGGCCTCAAGTGGGTATTTGTG
NM_001159999.1      GTGTG------------------------------------------------------A
NM_001160004.1      GTGTG------------------------------------------------------A
NM_001160008.1      GTGTG------------------------------------------------------A
                    .                                                           

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      GACAAGATCTTTGAATATGACTCTCCTACTCACCTTGACCCTGGGGGGTTAGGCCAGGAC
NM_001160001.1      AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
NM_013962.2         --CCTCGGTGTGCTACTCGTCCCCGCCCAGCGTGGGATCGGTGCAGGAGCTAGCTCAGCG
XM_005273486.1      GACAAGATCTTTGAATATGACTCTCCTACTCACCTTGACCCTGGGGGGTTAGGCCAGGAC
NM_013956.3         AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
NM_001159995.1      AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
NM_013959.3         ------------------------------------------------------------
NM_013957.3         AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
XM_005273485.1      GACAAGATCTTTGAATATGACTCTCCTACTCACCTTGACCCTGGGGGGTTAGGCCAGGAC
NM_001159999.1      AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
NM_001160004.1      AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
NM_001160008.1      AACCAGTTCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAA
                                                                                

HsCD00003684        --AAGATGGGAGAACCCCTGGACTCGTGGGCCTGGCCGTGCCCTGCTGTGCGTGCCTAGA
XM_005273487.1      CCTATTATTTCTCTGGACGCAACTGCTGCCTCAGCTGTGTGGGTGTCGTCTGAGGCATAC
NM_001160001.1      TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
NM_013962.2         CGCCGCGGTGGTGATCGAGGGAAAGGTGCACCCGCAGCGGCGGCAGCAGGGGGCACTCGA
XM_005273486.1      CCTATTATTTCTCTGGACGCAACTGCTGCCTCAGCTGTGTGGGTGTCGTCTGAGGCATAC
NM_013956.3         TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
NM_001159995.1      TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
NM_013959.3         --AAGATGGGAGAACCCCTGGACTCGTGGGCCTGGCCGTGCCCTGCTGTGCGTGCCTAGA
NM_013957.3         TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
XM_005273485.1      CCTATTATTTCTCTGGACGCAACTGCTGCCTCAGCTGTGTGGGTGTCGTCTGAGGCATAC
NM_001159999.1      TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
NM_001160004.1      TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
NM_001160008.1      TCGAAAAAACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCG
                       .             .  .:.:  :*   * .          .  .   .   *:   

HsCD00003684        AGCTGAGCGCCTGAGAGGTTGCCTCAACTCAGAGAAAATCTGCATTGTCCCCATCCTGGC
XM_005273487.1      ACTTCACCTGTCTCTAGGGCTCAATCTGAAAGTGAGGTTCAAGTTACAGTGCAAGGTGAC
NM_001160001.1      CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
NM_013962.2         CAGGAAGGCGGCGGCGGCGGCGGGCGAGGCAGGGGCGTGGGGCGGCGATCGCGAGCCGCC
XM_005273486.1      ACTTCACCTGTCTCTAGGGCTCAATCTGAAAGTGAGGTTCAAGTTACAGTGCAAGGTGAC
NM_013956.3         CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
NM_001159995.1      CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
NM_013959.3         AGCTGAGCGCCTGAGAGGTTGCCTCAACTCAGAGAAAATCTGCATTGTCCCCATCCTGGC
NM_013957.3         CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
XM_005273485.1      ACTTCACCTGTCTCTAGGGCTCAATCTGAAAGTGAGGTTCAAGTTACAGTGCAAGGTGAC
NM_001159999.1      CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
NM_001160004.1      CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
NM_001160008.1      CATTAACAAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATT
                    .    *         .              ** *   :   .     :   *.    .  

HsCD00003684        TTG---------------------------------------------------------
XM_005273487.1      AAGGCTGTTGTCTCCTTTGAACCATCAGCGGCACCGACACCGAAGAATCGTATTTTTGCC
NM_001160001.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_013962.2         AGCCG--------------------CGGGCCCACGGGCGCTGGGGCCGCCCGCCGAGGAG
XM_005273486.1      AAGGCTGTTGTCTCCTTTGAACCATCAGCGGCACCGACACCGAAGAATCGTATTTTTGCC
NM_013956.3         AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001159995.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_013959.3         TTG---------------------------------------------------------
NM_013957.3         AGG--------------------------------------AAATGACAGTGCCTCTGCC
XM_005273485.1      AAGGCTGTTGTCTCCTTTGAACCATCAGCGGCACCGACACCGAAGAATCGTATTTTTGCC
NM_001159999.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001160004.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001160008.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
                    :                                                           

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      TTTTCTTTCTTGCCGTCCACTGCGCCATCCTTCCCTTCACCCACCCGGAACCCTGAGGTG
NM_001160001.1      AATATCACCATCGTG---------------------------------------------
NM_013962.2         CCGCTGCTCGCCGCCAACGGGACCGTGCCCTCTTGGCCCACCGCCCCGGTGCCCAGCGCC
XM_005273486.1      TTTTCTTTCTTGCCGTCCACTGCGCCATCCTTCCCTTCACCCACCCGGAACCCTGAGGTG
NM_013956.3         AATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAGGA
NM_001159995.1      AATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAG--
NM_013959.3         ------------------------------------------------------------
NM_013957.3         AATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAGGA
XM_005273485.1      TTTTCTTTCTTGCCGTCCACTGCGCCATCCTTCCCTTCACCCACCCGGAACCCTGAGGTG
NM_001159999.1      AATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAGGA
NM_001160004.1      AATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAGGA
NM_001160008.1      AATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCAGCCTCAACTGAAGGA
                                                                                

HsCD00003684        ----------------------------------------------------CCTGGTCA
XM_005273487.1      AGAACGCCCAAGTCAGCAACTCAGCCACAAACAACAGAAACTAATCTCCAAACTGCTCCT
NM_001160001.1      ---------------------------------------------------------GAA
NM_013962.2         GGCGAGCCCGGGGAGGAGGCGCCCTATCTGGTGAAGGTGCACCAGGTGTGGGCGGTGAAA
XM_005273486.1      AGAACGCCCAAGTCAGCAACTCAGCCACAAACAACAGAAACTAATCTCCAAACTGCTCCT
NM_013956.3         GCATATGTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACAGAAGGAGCAAATACT
NM_001159995.1      -------------------------------------------------GAGCATATGTG
NM_013959.3         ----------------------------------------------------CCTGGTCA
NM_013957.3         GCATATGTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACAGAAGGAGCAAATACT
XM_005273485.1      AGAACGCCCAAGTCAGCAACTCAGCCACAAACAACAGAAACTAATCTCCAAACTGCTCCT
NM_001159999.1      GCATATGTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACAGAAGGAGCAAATACT
NM_001160004.1      GCATATGTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACAGAAGGAGCAAATACT
NM_001160008.1      GCATATGTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACAGAAGGAGCAAATACT
                                                                                

HsCD00003684        GCCTCTGCCTCTGCATCGCCGGCCTCAAGTGGGTATTTGTGGACAAGATCTTTGAATATG
XM_005273487.1      AAACTTTCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_001160001.1      TCAAACGCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_013962.2         GCCGGGGGCTTGAAGAAGGACTCGCTGCTCACCGTGCGCCTGGGGACCTGGGGCCACCCC
XM_005273486.1      AAACTTTCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_013956.3         TCTTCATCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_001159995.1      TCTTCAGCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_013959.3         GCCTCTGCCTCTGCATCGCCGGCCTCAAGTGGGTATTTGTGGACAAGATCTTTGAATATG
NM_013957.3         TCTTCATCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
XM_005273485.1      AAACTTTCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_001159999.1      TCTTCATCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_001160004.1      TCTTCATCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
NM_001160008.1      TCTTCATCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAG
                     .       :   . :.. .  *       .           . .* .*      * .  

HsCD00003684        ACTCTCCTACTCACCTTGACCCTGGGGGGTTAGGCCAGG---------------------
XM_005273487.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_001160001.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_013962.2         GCCTTCCCCTCCTGCGGGAGGCTCAAGGAGGACAGCAGGTACATCTTCTTCATGGAGCCC
XM_005273486.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_013956.3         GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_001159995.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_013959.3         ACTCTCCTACTCACCTTGACCCTGGGGGGTTAGGCCAGG---------------------
NM_013957.3         GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
XM_005273485.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_001159999.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_001160004.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
NM_001160008.1      GAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCC
                    ..  :..    *:    **     ..**.  .   ** *                     

HsCD00003684        --------------------ACCCTATTATTTCTCTGGACGCAACTGCTGCCTCAGCTCT
XM_005273487.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_001160001.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_013962.2         GACGCCAACAGCACCAGCCGCGCGCCGGCCGCCTTCCGAGCCTCTTTCCCCCCTCTGGAG
XM_005273486.1      TCGAGATACTTGTGCAAGTGCCAACCTGGATTCACTGGAGCAAGATGTACTGAGAATGTG
NM_013956.3         TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_001159995.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_013959.3         --------------------ACCCTATTATTTCTCTGGACGCAACTGCTGCCTCAGCTGT
NM_013957.3         TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
XM_005273485.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_001159999.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_001160004.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
NM_001160008.1      TCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTA
                                        . .  .       :   *:      *              

HsCD00003684        GTGGGTGTCGTCTGAGG-------------------------------------------
XM_005273487.1      ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
NM_001160001.1      ATGGCCAGCTTCTACAAGCATCTTGGGATTGAATTTATGGAGGCGGAGGAGCTGTACCAG
NM_013962.2         ACGGGCCGGAACCTCAAGAAGGAGG---------------------------------TC
XM_005273486.1      CCCATGAAAGTCCAAAACCAAGAAAAG---------------GCGGAGGAGCTGTACCAG
NM_013956.3         ATGGCCAGCTTCTACAAGCATCTTGGGATTGAATTTATGGAGGCGGAGGAGCTGTACCAG
NM_001159995.1      ATGGCCAGCTTCTACAAGCATCTTGGGATTGAATTTATGGAGGCGGAGGAGCTGTACCAG
NM_013959.3         GTGGGTGTCGTCTGAGG-------------------------------------------
NM_013957.3         ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
XM_005273485.1      ATGGCCAGCTTCTACAAGCATCTTGGGATTGAATTTATGGAGGCGGAGGAGCTGTACCAG
NM_001159999.1      ATGGCCAGCTTCTACAAGCATCTTGGGATTGAATTTATGGAGGCGGAGGAGCTGTACCAG
NM_001160004.1      ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
NM_001160008.1      ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
                       .      :*  ...                                           

HsCD00003684        -----------------------CATACACTTCACCTGTCTCTAGGGCTCAATCTGAAAG
XM_005273487.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_001160001.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_013962.2         AGCCGGGTGCTGTGCAAGCGGTGCGCCTTGCCTCCCCGATTGAAAGAGATGAAAAGCCAG
XM_005273486.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_013956.3         AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_001159995.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_013959.3         -----------------------CATACACTTCACCTGTCTCTAGGGCTCAATCTGAAAG
NM_013957.3         AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
XM_005273485.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_001159999.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_001160004.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
NM_001160008.1      AAGAGAGTGCTGACCATAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT
                                           *. .       **    *  :.*     *:.:   . 

HsCD00003684        TGAGGTTCAAGTTACAGTGCAAGGTGACAAGGCTGTTGTCTCCTTTGAACCATCAGCGGC
XM_005273487.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_001160001.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_013962.2         GAATCGGCTGCAGGTTCCAAACTAGTCCTTCGGTGTGAAACCAGTTCTGAATACTCCTCT
XM_005273486.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_013956.3         GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_001159995.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_013959.3         TGAGGTTCAAGTTACAGTGCAAGGTGACAAGGCTGTTGTCTCCTTTGAACCATCAGCGGC
NM_013957.3         GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
XM_005273485.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_001159999.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_001160004.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
NM_001160008.1      GTGGTGGCCTACTGCAAAACCAAGAAACAGCGGAAAAAGCTGCATG--ACCGTCTTCGGC
                      .    *     . :  .... .  .*:  * :.: . .  . *   ... :*: *   

HsCD00003684        ACCGACACCGAAGAATCGTATTTTTGCCTTTTCTTTCTTGCCGTCCACTGCGCCATCCTT
XM_005273487.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_001160001.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_013962.2         CTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAATCGAAAAAACAAACCACAAAAT
XM_005273486.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_013956.3         AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_001159995.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_013959.3         ACCGACACCGAAGAATCGTATTTTTGCCTTTTCTTTCTTGCCGTCCACTGCGCCATCCTT
NM_013957.3         AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
XM_005273485.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_001159999.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_001160004.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
NM_001160008.1      AGAGCCTTCGGTCTGAACGAAACAATATGATGAACATTGCCAATGGGCCTCACCATCCTA
                    . .. .: *..   .:   * : :     :  .:   :   ..:  .*  . *..:..::

HsCD00003684        CCCTTCACCCACCCGGAACCCTGAGG-----------------------TGAGAACGCCC
XM_005273487.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_001160001.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_013962.2         ATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCGCATTAACAAAGCATCACTGGCT
XM_005273486.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_013956.3         ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_001159995.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_013959.3         CCCTTCACCCACCCGGAACCCTGAGG-----------------------TGAGAACGCCC
NM_013957.3         ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
XM_005273485.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_001159999.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_001160004.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
NM_001160008.1      ACCCACCCCCCGAGAATGTCCAGCTGGTGAATCAATACGTATCTAAAAACGTCATCTCCA
                    . * : . .*. . ..:. *. *  .                        .: *    * 

HsCD00003684        AAGTCAGCAACTCAGCC----ACAAACAACAGAAACTAATCTCCAAACTGCTCCTAAACT
XM_005273487.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_001160001.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_013962.2         GATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATTAGGAAATGACAGTGCCTCTGCC
XM_005273486.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_013956.3         GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_001159995.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_013959.3         AAGTCAGCAACTCAGCC----ACAAACAACAGAAACTAATCTCCAAACTGCTCCTAAACT
NM_013957.3         GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
XM_005273485.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_001159999.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_001160004.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
NM_001160008.1      GTGAGCATATTGTTGAG----AGAGAAGCAGAGACATCCTTTTCCACCAGTCACTATACT
                    .: :  . *    : .     * *.: . ... *..* .  : . ..*:*  .**.:.* 

HsCD00003684        TTCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAG--
XM_005273487.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_001160001.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_013962.2         AATATCACCATCGTGGAATCAAACGCTACATCTACATCCACCACTGGGACAAGCCATCTT
XM_005273486.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_013956.3         TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_001159995.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_013959.3         TTCTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAG--
NM_013957.3         TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
XM_005273485.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_001159999.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_001160004.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
NM_001160008.1      TCCACAGCCCATCACTCCACTACTGTCACCCAGACTCCTAGCCACAGCTGGAGCAACGGA
                    :  : .. * :  :  .. . :  *  *.  . :*:   * ..   *   .... .    

HsCD00003684        ---------------------AAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTG
XM_005273487.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_001160001.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_013962.2         GTAAAATGTGCGGAGAAGGAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTG
XM_005273486.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_013956.3         CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_001159995.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_013959.3         ---------------------AAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTG
NM_013957.3         CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
XM_005273485.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_001159999.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_001160004.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
NM_001160008.1      CACACTGAAAGCATCCTTTCCGAAAGCCACTCTGTAATCGTGATGTCATCCGTAGAAAAC
                                         .***   :** ***.*: * .. * ..* * *..:..: 

HsCD00003684        AAAGACCTTTCAAACCCCTCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGAT
XM_005273487.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_001160001.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_013962.2         AAAGACCTTTCAAACCCCTCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGAT
XM_005273486.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_013956.3         AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_001159995.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_013959.3         AAAGACCTTTCAAACCCCTCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGAT
NM_013957.3         AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
XM_005273485.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_001159999.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_001160004.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
NM_001160008.1      AGTAGGCACAGCAGCCCAACTGGGGGCCCAAGAGGACGTCTTAATGGCACAGGAGGCCCT
                    *.:.. *: : .*.***.:* .*. .*  .:*.... * * :****. : :. :**  .*

HsCD00003684        CGCTGCCAAAACTACGTAATGGCCAGCTTCTACAGTACGTCCACTCCCTTTCTGTCTCTG
XM_005273487.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_001160001.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_013962.2         CGCTGCCAAAACTACGTAATGGCCAGCTTCTACAGTACGTCCACTCCCTTTCTGTCTCTG
XM_005273486.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_013956.3         CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_001159995.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_013959.3         CGCTGCCAAAACTACGTAATGGCCAGCTTCTACAGTACGTCCACTCCCTTTCTGTCTCTG
NM_013957.3         CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
XM_005273485.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_001159999.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_001160004.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
NM_001160008.1      CGTGAATGTAACAGCTTCCTCAGGCATGCCAGAGAAACCCCTGATTCCTACCGAGACTCT
                    **  .. .:***:.* *..* .  ..   *:....:**  * ..* ***: * . .    

HsCD00003684        CCTGAATTG---------------------------------------------------
XM_005273487.1      CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_001160001.1      CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_013962.2         CCTGAATAG---------------------------------------------------
XM_005273486.1      CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_013956.3         CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_001159995.1      CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_013959.3         CCTGAATAG---------------------------------------------------
NM_013957.3         CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
XM_005273485.1      CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_001159999.1      CCTCATAGTGAAAGGTATGTGTCAGCCATGACCACCCCGGCTCGTATGTCACCTGTAGAT
NM_001160004.1      CCTCATAGTGAAAGACATAACCTTATAGCTGAGCTAAGGAGAAACAAGGCACACAGATCC
NM_001160008.1      CCTCATAGTGAAAGGTAA------------------------------------------
                    *** *::                                                     

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_001160001.1      TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_013956.3         TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_001159995.1      TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_013959.3         ------------------------------------------------------------
NM_013957.3         TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
XM_005273485.1      TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_001159999.1      TTCCACACGCCAAGCTCCCCCAAATCGCCCCCTTCGGAAATGTCTCCACCCGTGTCCAGC
NM_001160004.1      AAATGCATGCAGATCCAGCTATCAGCAACTCATCTTAGATCTTCTTCCATTCCCCATTTG
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_001160001.1      ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_013956.3         ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_001159995.1      ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_013959.3         ------------------------------------------------------------
NM_013957.3         ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
XM_005273485.1      ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_001159999.1      ATGACGGTGTCCATGCCTTCCATGGCGGTCAGCCCCTTCATGGAAGAAGAGAGACCTCTA
NM_001160004.1      GGCTTCATTCTCTAA---------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_001160001.1      CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_013956.3         CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_001159995.1      CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_013959.3         ------------------------------------------------------------
NM_013957.3         CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
XM_005273485.1      CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_001159999.1      CTTCTCGTGACACCACCAAGGCTGCGGGAGAAGAAGTTTGACCATCACCCTCAGCAGTTC
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_001160001.1      AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_013956.3         AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_001159995.1      AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_013959.3         ------------------------------------------------------------
NM_013957.3         AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
XM_005273485.1      AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_001159999.1      AGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGG
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_001160001.1      ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_013956.3         ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_001159995.1      ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_013959.3         ------------------------------------------------------------
NM_013957.3         ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
XM_005273485.1      ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_001159999.1      ATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTT
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_001160001.1      AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_013956.3         AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_001159995.1      AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_013959.3         ------------------------------------------------------------
NM_013957.3         AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
XM_005273485.1      AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_001159999.1      AAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAAC
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_001160001.1      AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_013956.3         AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_001159995.1      AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_013959.3         ------------------------------------------------------------
NM_013957.3         AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
XM_005273485.1      AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_001159999.1      AGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAA
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_001160001.1      GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_013956.3         GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_001159995.1      GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_013959.3         ------------------------------------------------------------
NM_013957.3         GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
XM_005273485.1      GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_001159999.1      GATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAACCCCCTGGCAGCCAGT
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_001160001.1      CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_013956.3         CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_001159995.1      CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_013959.3         ------------------------------------------------------------
NM_013957.3         CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
XM_005273485.1      CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_001159999.1      CTTGAGGCAACACCTGCCTTCCGCCTGGCTGACAGCAGGACTAACCCAGCAGGCCGCTTC
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ------------------------------------------------------------
XM_005273487.1      TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_001160001.1      TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_013962.2         ------------------------------------------------------------
XM_005273486.1      TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_013956.3         TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_001159995.1      TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_013959.3         ------------------------------------------------------------
NM_013957.3         TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
XM_005273485.1      TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_001159999.1      TCGACACAGGAAGAAATCCAGGCCAGGCTGTCTAGTGTAATTGCTAACCAAGACCCTATT
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------
                                                                                

HsCD00003684        ---------
XM_005273487.1      GCTGTATAA
NM_001160001.1      GCTGTATAA
NM_013962.2         ---------
XM_005273486.1      GCTGTATAA
NM_013956.3         GCTGTATAA
NM_001159995.1      GCTGTATAA
NM_013959.3         ---------
NM_013957.3         GCTGTATAA
XM_005273485.1      GCTGTATAA
NM_001159999.1      GCTGTATAA
NM_001160004.1      ---------
NM_001160008.1      ---------
                             

Pathways

NCI : Glypican 1 network
NCI : Validated transcriptional targets of deltaNp63 isoforms
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in ERBB2 signaling
Reactome : GRB7 events in ERBB2 signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear signaling by ERBB4
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : ErbB signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Protein

SMART domain : EGF : Epidermal growth factor-like domain.
UniProt : Q02297
UniProt : Q7RTW3
UniProt : Q6PK61
UniProt : B0FYA8
UniProt : B0FYA9
UniProt : B0FYA7
UniProt : B7Z4Z3
UniProt : A6MW55
UniProt : A6MW56
UniProt : B0FWZ3
UniProt : Q7RTW5
UniProt : E9PHH4
UniProt : B7Z1D7
HPRD : 00802

Clone

Cloning Information : 14040
HIP Master Clone ID : 28239
Original Clone ID : FLH014040.01L

Organism


TAX_ID : 9606
Species Specific ID: 3084

Genome

Chromosome : 8
Map Location : 8p12
Ensembl : ENSG00000157168

Reagents

Labome : NRG1-antibody