DNASU Plasmid Repository • 480.965.5697 | Email

GUK1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GUK1
Gene Name:  guanylate kinase 1
Sequence             
Original Clone ID: FLH138523.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037960

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 594nts         Open reading frame : 1 to 594
Reference Sequence Alignment

ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCTG
CTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCACG
AGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGTG
ATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAACCTG
TATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTGCTG
GACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTACATC
TCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACTGAA
ACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAAG
GAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAG
CTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 818
Start on reference sequence 225
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GUK1
Symbol Nomenclature : GUK1
SYNONYM : GMK
Designation : ATP:GMP phosphotransferase|GMP kinase|guanylate kinase
Full Nomenclature : guanylate kinase 1
GENEID : 2987
Locus Tag : RP11-520H14.2
HGNC : 4693
MIM : 139270
Vega : OTTHUMG00000039503
Target GenBank: BC009914

 

Reference Sequence Alignment

  

HsCD00037960        ------------------------------------------------------------
NM_001242840.1      ATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGAC
NM_001159391.1      ------------------------------------------------------------
NM_001242839.1      ------------------------------------------------------------
NM_001159390.1      ATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGAC
NM_000858.5         ------------------------------------------------------------
XM_005273106.1      ------------------------------------------------------------
                                                                                

HsCD00037960        ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001242840.1      GGCATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001159391.1      ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001242839.1      ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001159390.1      GGCATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_000858.5         ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
XM_005273106.1      ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
                       *********************************************************

HsCD00037960        CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001242840.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001159391.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001242839.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001159390.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_000858.5         CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
XM_005273106.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
                    ************************************************************

HsCD00037960        ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001242840.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001159391.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001242839.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001159390.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_000858.5         ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
XM_005273106.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
                    ************************************************************

HsCD00037960        GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001242840.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001159391.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001242839.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001159390.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_000858.5         GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
XM_005273106.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
                    ************************************************************

HsCD00037960        CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001242840.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001159391.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001242839.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001159390.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_000858.5         CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
XM_005273106.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
                    ************************************************************

HsCD00037960        CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001242840.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001159391.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001242839.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001159390.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_000858.5         CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
XM_005273106.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
                    ************************************************************

HsCD00037960        ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001242840.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001159391.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001242839.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001159390.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_000858.5         ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
XM_005273106.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
                    ************************************************************

HsCD00037960        GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_001242840.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGA
NM_001159391.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_001242839.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_001159390.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_000858.5         GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
XM_005273106.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGA
                    ***********************************************************.

HsCD00037960        AAGGAGCCCGGCCTGTTTGATG--------------------------------------
NM_001242840.1      AATCAAGAAAGCTCAAAGGACCGGCGCCTGAGGCTTGCTGTCTGTTCTCGGCACCCCGGG
NM_001159391.1      AAGGAGCCCGGCCTGTTTGATG--------------------------------------
NM_001242839.1      AAGGAGCCCGGCCTGTTTGATG--------------------------------------
NM_001159390.1      AAGGAGCCCGGCCTGTTTGATG--------------------------------------
NM_000858.5         AAGGAGCCCGGCCTGTTTGATG--------------------------------------
XM_005273106.1      AATCAAGAAAGCTCAAAGGACCGGCGCCTGAGGCTTGCTGTCTGTTCTCGGCACCCCGGG
                    **  *. ...**  .:: **                                        

HsCD00037960        ----TGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTC
NM_001242840.1      CCCATACAGGACCAGGGCAGCAGCATTGAGCCACCCCCTTGGCAGGCGATACGGCAGCTC
NM_001159391.1      ----TGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTC
NM_001242839.1      ----TGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTC
NM_001159390.1      ----TGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTC
NM_000858.5         ----TGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTC
XM_005273106.1      CCCATACAGGACCAGGGCAGCAGCATTGAGCCACCCCCTTGGCAGGCGATACGGCAGCTC
                        *. : .:*.: ..*..****.* ** *.. ** .   . **  **:. .* .****

HsCD00037960        TCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTTG---------------------
NM_001242840.1      TGTGCCCTTGGCCAGCATGTGGAGTGGAGGAGATGCTGCCCCTGTGGTTGGAACATCCTG
NM_001159391.1      TCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA---------------------
NM_001242839.1      TCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA---------------------
NM_001159390.1      TCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA---------------------
NM_000858.5         TCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA---------------------
XM_005273106.1      TGTGCCCTTGGCCAGCATGTGGAGTGGAGGAGATGCTGCCCCTGTGGTTGGAACATCCTG
                    * **.  ::. *.**.*:*   *.:***  .*.  **                       

HsCD00037960        ------
NM_001242840.1      GGGTGA
NM_001159391.1      ------
NM_001242839.1      ------
NM_001159390.1      ------
NM_000858.5         ------
XM_005273106.1      GGGTGA
                          

Pathways

Panther : De novo purine biosynthesis
Reactome : Abacavir metabolism
Reactome : Abacavir transport and metabolism
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Synthesis and interconversion of nucleotide di- and triphosphates

Protein

SMART domain : GuKc : Guanylate kinase homologues.
UniProt : B4E1H6
UniProt : Q6IBG8
UniProt : Q16774
HPRD : 00755

Clone

Cloning Information : 138523
HIP Master Clone ID : 87187
Original Clone ID : FLH138523.01L

Organism


TAX_ID : 9606
Species Specific ID: 2987

Genome

Chromosome : 1
Map Location : 1q32-q41
Ensembl : ENSG00000143774

Reagents

Labome : GUK1-antibody