DNASU Plasmid Repository • 480.965.5697 | Email

CAMK4 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CAMK4
Gene Name:  calcium/calmodulin-dependent protein kinase IV
Sequence             
Original Clone ID: FLH138563.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037998

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1422nts         Open reading frame : 1 to 1422
Reference Sequence Alignment

ATGCTCAAAGTCACGGTGCCCTCCTGCTCCGCCTCGTCCTGCTCTTCGGTCACCGCCAGT
GCGGCCCCGGGGACCGCGAGCCTCGTCCCGGATTACTGGATCGACGGCTCCAACAGGGAT
GCGCTGAGCGATTTCTTCGAGGTGGAGTCGGAGCTGGGACGGGGTGCTACATCCATTGTG
TACAGATGCAAACAGAAGGGGACCCAGAAGCCTTATGCTCTCAAAGTGTTAAAGAAAACA
GTGGACAAAAAAATCGTAAGAACTGAGATAGGAGTTCTTCTTCGCCTCTCACATCCAAAC
ATTATAAAACTTAAAGAGATATTTGAAACCCCTACAGAAATCAGTCTGGTCCTAGAACTC
GTCACAGGAGGAGAACTGTTTGATAGGATTGTGGAAAAGGGATATTACAGTGAGCGAGAT
GCTGCAGATGCCGTTAAACAAATCCTGGAGGCAGTTGCTTATCTACATGAAAATGGGATT
GTCCATCGTGATCTCAAACCAGAGAATCTTCTTTATGCAACTCCAGCCCCAGATGCACCA
CTCAAAATCGCTGATTTTGGACTCTCTAAAATTGTGGAACATCAAGTGCTCATGAAGACA
GTATGTGGAACCCCAGGGTACTGCGCACCTGAAATTCTTAGAGGTTGTGCCTATGGACCT
GAGGTGGACATGTGGTCTGTAGGAATAATCACCTACATCTTACTTTGTGGATTTGAACCA
TTCTATGATGAAAGAGGCGATCAGTTCATGTTCAGGAGAATTCTGAATTGTGAATATTAC
TTTATCTCCCCCTGGTGGGATGAAGTATCTCTAAATGCCAAGGACTTGGTCAGAAAATTA
ATTGTTTTGGATCCAAAGAAACGGCTGACTACATTTCAAGCTCTCCAGCATCCGTGGGTC
ACAGGTAAAGCAGCCAATTTTGTACACATGGATACCGCTCAAAAGAAGCTCCAAGAATTC
AATGCCCGGCGTAAGCTTAAGGCAGCGGTGAAGGCTGTGGTGGCCTCTTCCCGCCTGGGA
AGTGCCAGCAGCAGCCATGGCAGCATCCAGGAGAGCCACAAGGCTAGCCGAGACCCTTCT
CCAATCCAAGATGGCAACGAGGACATGAAAGCTATTCCAGAAGGAGAGAAAATTCAAGGC
GATGGGGCCCAAGCCGCAGTTAAGGGGGCACAGGCTGAGCTGATGAAGGTGCAAGCCTTA
GAGAAAGTTAAAGGTGCAGATATAAATGCTGAAGAGGCCCCCAAAATGGTGCCCAAGGCA
GTGGAGGATGGGATAAAGGTGGCTGACCAGGAACTAGAGGAGGGCCTAGCAGAGGAGAAG
CTGAAGACTGTGGAGGAGGCAGCAGCTCCCAGAGAAGGGCAAGGAAGCTCTGCTGTGGGT
TTTGAAGTTCCACAGCAAGATGTGATCCTGCCAGAGTACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1499
Start on reference sequence 78
Mutations:
None
Discrepancy:
t1289a,L430Q
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CAMK4
Symbol Nomenclature : CAMK4
SYNONYM : CaMK IV; CaMK-GR; IV; caMK
Designation : CAM kinase IV|CAM kinase- GR|brain Ca(2+)-calmodulin-dependent protein kinase type IV|brain Ca++-calmodulin-dependent protein kinase type IV|caM kinase-GR|calcium/calmodulin-dependent protein kinase type IV|calcium/calmodulin-dependent protein kinase type IV catalytic chain
Full Nomenclature : calcium/calmodulin-dependent protein kinase IV
GENEID : 814
HGNC : 1464
MIM : 114080
Target GenBank: NM_001744

 

Reference Sequence Alignment

  

HsCD00037998      ATGCTCAAAGTCACGGTGCCCTCCTGCTCCGCCTCGTCCTGCTCTTCGGTCACCGCCAGT
NM_001744.4       ATGCTCAAAGTCACGGTGCCCTCCTGCTCCGCCTCGTCCTGCTCTTCGGTCACCGCCAGT
                  ************************************************************

HsCD00037998      GCGGCCCCGGGGACCGCGAGCCTCGTCCCGGATTACTGGATCGACGGCTCCAACAGGGAT
NM_001744.4       GCGGCCCCGGGGACCGCGAGCCTCGTCCCGGATTACTGGATCGACGGCTCCAACAGGGAT
                  ************************************************************

HsCD00037998      GCGCTGAGCGATTTCTTCGAGGTGGAGTCGGAGCTGGGACGGGGTGCTACATCCATTGTG
NM_001744.4       GCGCTGAGCGATTTCTTCGAGGTGGAGTCGGAGCTGGGACGGGGTGCTACATCCATTGTG
                  ************************************************************

HsCD00037998      TACAGATGCAAACAGAAGGGGACCCAGAAGCCTTATGCTCTCAAAGTGTTAAAGAAAACA
NM_001744.4       TACAGATGCAAACAGAAGGGGACCCAGAAGCCTTATGCTCTCAAAGTGTTAAAGAAAACA
                  ************************************************************

HsCD00037998      GTGGACAAAAAAATCGTAAGAACTGAGATAGGAGTTCTTCTTCGCCTCTCACATCCAAAC
NM_001744.4       GTGGACAAAAAAATCGTAAGAACTGAGATAGGAGTTCTTCTTCGCCTCTCACATCCAAAC
                  ************************************************************

HsCD00037998      ATTATAAAACTTAAAGAGATATTTGAAACCCCTACAGAAATCAGTCTGGTCCTAGAACTC
NM_001744.4       ATTATAAAACTTAAAGAGATATTTGAAACCCCTACAGAAATCAGTCTGGTCCTAGAACTC
                  ************************************************************

HsCD00037998      GTCACAGGAGGAGAACTGTTTGATAGGATTGTGGAAAAGGGATATTACAGTGAGCGAGAT
NM_001744.4       GTCACAGGAGGAGAACTGTTTGATAGGATTGTGGAAAAGGGATATTACAGTGAGCGAGAT
                  ************************************************************

HsCD00037998      GCTGCAGATGCCGTTAAACAAATCCTGGAGGCAGTTGCTTATCTACATGAAAATGGGATT
NM_001744.4       GCTGCAGATGCCGTTAAACAAATCCTGGAGGCAGTTGCTTATCTACATGAAAATGGGATT
                  ************************************************************

HsCD00037998      GTCCATCGTGATCTCAAACCAGAGAATCTTCTTTATGCAACTCCAGCCCCAGATGCACCA
NM_001744.4       GTCCATCGTGATCTCAAACCAGAGAATCTTCTTTATGCAACTCCAGCCCCAGATGCACCA
                  ************************************************************

HsCD00037998      CTCAAAATCGCTGATTTTGGACTCTCTAAAATTGTGGAACATCAAGTGCTCATGAAGACA
NM_001744.4       CTCAAAATCGCTGATTTTGGACTCTCTAAAATTGTGGAACATCAAGTGCTCATGAAGACA
                  ************************************************************

HsCD00037998      GTATGTGGAACCCCAGGGTACTGCGCACCTGAAATTCTTAGAGGTTGTGCCTATGGACCT
NM_001744.4       GTATGTGGAACCCCAGGGTACTGCGCACCTGAAATTCTTAGAGGTTGTGCCTATGGACCT
                  ************************************************************

HsCD00037998      GAGGTGGACATGTGGTCTGTAGGAATAATCACCTACATCTTACTTTGTGGATTTGAACCA
NM_001744.4       GAGGTGGACATGTGGTCTGTAGGAATAATCACCTACATCTTACTTTGTGGATTTGAACCA
                  ************************************************************

HsCD00037998      TTCTATGATGAAAGAGGCGATCAGTTCATGTTCAGGAGAATTCTGAATTGTGAATATTAC
NM_001744.4       TTCTATGATGAAAGAGGCGATCAGTTCATGTTCAGGAGAATTCTGAATTGTGAATATTAC
                  ************************************************************

HsCD00037998      TTTATCTCCCCCTGGTGGGATGAAGTATCTCTAAATGCCAAGGACTTGGTCAGAAAATTA
NM_001744.4       TTTATCTCCCCCTGGTGGGATGAAGTATCTCTAAATGCCAAGGACTTGGTCAGAAAATTA
                  ************************************************************

HsCD00037998      ATTGTTTTGGATCCAAAGAAACGGCTGACTACATTTCAAGCTCTCCAGCATCCGTGGGTC
NM_001744.4       ATTGTTTTGGATCCAAAGAAACGGCTGACTACATTTCAAGCTCTCCAGCATCCGTGGGTC
                  ************************************************************

HsCD00037998      ACAGGTAAAGCAGCCAATTTTGTACACATGGATACCGCTCAAAAGAAGCTCCAAGAATTC
NM_001744.4       ACAGGTAAAGCAGCCAATTTTGTACACATGGATACCGCTCAAAAGAAGCTCCAAGAATTC
                  ************************************************************

HsCD00037998      AATGCCCGGCGTAAGCTTAAGGCAGCGGTGAAGGCTGTGGTGGCCTCTTCCCGCCTGGGA
NM_001744.4       AATGCCCGGCGTAAGCTTAAGGCAGCGGTGAAGGCTGTGGTGGCCTCTTCCCGCCTGGGA
                  ************************************************************

HsCD00037998      AGTGCCAGCAGCAGCCATGGCAGCATCCAGGAGAGCCACAAGGCTAGCCGAGACCCTTCT
NM_001744.4       AGTGCCAGCAGCAGCCATGGCAGCATCCAGGAGAGCCACAAGGCTAGCCGAGACCCTTCT
                  ************************************************************

HsCD00037998      CCAATCCAAGATGGCAACGAGGACATGAAAGCTATTCCAGAAGGAGAGAAAATTCAAGGC
NM_001744.4       CCAATCCAAGATGGCAACGAGGACATGAAAGCTATTCCAGAAGGAGAGAAAATTCAAGGC
                  ************************************************************

HsCD00037998      GATGGGGCCCAAGCCGCAGTTAAGGGGGCACAGGCTGAGCTGATGAAGGTGCAAGCCTTA
NM_001744.4       GATGGGGCCCAAGCCGCAGTTAAGGGGGCACAGGCTGAGCTGATGAAGGTGCAAGCCTTA
                  ************************************************************

HsCD00037998      GAGAAAGTTAAAGGTGCAGATATAAATGCTGAAGAGGCCCCCAAAATGGTGCCCAAGGCA
NM_001744.4       GAGAAAGTTAAAGGTGCAGATATAAATGCTGAAGAGGCCCCCAAAATGGTGCCCAAGGCA
                  ************************************************************

HsCD00037998      GTGGAGGATGGGATAAAGGTGGCTGACCAGGAACTAGAGGAGGGCCTAGCAGAGGAGAAG
NM_001744.4       GTGGAGGATGGGATAAAGGTGGCTGACCTGGAACTAGAGGAGGGCCTAGCAGAGGAGAAG
                  ****************************:*******************************

HsCD00037998      CTGAAGACTGTGGAGGAGGCAGCAGCTCCCAGAGAAGGGCAAGGAAGCTCTGCTGTGGGT
NM_001744.4       CTGAAGACTGTGGAGGAGGCAGCAGCTCCCAGAGAAGGGCAAGGAAGCTCTGCTGTGGGT
                  ************************************************************

HsCD00037998      TTTGAAGTTCCACAGCAAGATGTGATCCTGCCAGAGTACTTG
NM_001744.4       TTTGAAGTTCCACAGCAAGATGTGATCCTGCCAGAGTACTAA
                  ****************************************:.

Pathways

NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class II
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
Reactome : Activation of CaMK IV
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : CREB phosphorylation through the activation of CaMKK
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : CaMK IV-mediated phosphorylation of CREB
Reactome : Calmodulin induced events
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : G-protein mediated events
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Mitochondrial biogenesis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : Organelle biogenesis and maintenance
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Post NMDA receptor activation events
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transcriptional activation of mitochondrial biogenesis
Reactome : Transmission across Chemical Synapses
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Energy Metabolism
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : Mitochondrial Gene Expression

Clone

Cloning Information : 138563
HIP Master Clone ID : 87227
Original Clone ID : FLH138563.01L

Organism


TAX_ID : 9606
Species Specific ID: 814

Genome

Chromosome : 5
Map Location : 5q21.3

Reagents

Labome : CAMK4-antibody