DNASU Plasmid Repository • 480.965.5697 | Email

PAPSS1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PAPSS1
Gene Name:  3'-phosphoadenosine 5'-phosphosulfate synthase 1
Sequence             
Original Clone ID: FLH138609.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038039

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1812nts         Open reading frame : 1 to 1812
Reference Sequence Alignment

ATGCAGAGAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGAGGT
CAGGTGGTGGGGACCAGAGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTGTCT
GGAGCGGGAAAGACTACTGTGAGCATGGCCTTGGAGGAGTACCTGGTTTGTCATGGTATT
CCATGCTACACTCTGGATGGTGACAATATTCGTCAAGGTCTCAATAAAAATCTTGGCTTT
AGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGCTAAACTGTTTGCA
GATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAACAAT
GCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCTCCT
CTGCATGTTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGAGAA
ATTAAAGGTTTCACTGGGATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTGGTG
CTGAAAACAGACTCCTGTGATGTAAATGACTGTGTCCAGCAAGTTGTGGAACTTCTACAG
GAACGGGATATTGTACCTGTGGATGCATCTTATGAAGTAAAAGAACTATATGTGCCAGAA
AATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACTGAAAATTAATAAA
GTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGCTTT
ATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGTGTC
ATTAACTTGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTGGAC
GGCTGTACAGCATTTGCTCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAATCCA
GAGTTTTTTGAGCACAGGAAAGAGGAGCGCTGTGCCAGACAGTGGGGAACGACATGCAAG
AACCACCCCTATATTAAGATGGTGATGGAACAAGGAGATTGGCTGATTGGAGGAGATCTT
CAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCGTCTTACTCCTACT
GAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTACGC
AACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTAGAG
AGGGGCTACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGATGAC
GATGTTCCTTTGATGTGGCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTTCTG
AATCCTGAGACGACAGTGGTGGCCATCTTCCCATCTCCCATGATGTATGCTGGACCAACT
GAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAGGAGCCAACTTTTACATTGTTGGA
CGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTATGAGCCAAGTCAT
GGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTTCGA
GTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCATGAA
GACTTTGAATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAACCA
CCTGAAGGTTTCATGGCTCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCCTTG
GAGAAAGCTTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1832
Start on reference sequence 21
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PAPSS1
Symbol Nomenclature : PAPSS1
SYNONYM : ATPSK1; PAPSS; SK1
Designation : 3-prime-phosphoadenosine 5-prime-phosphosulfate synthase 1|PAPS synthase 1|PAPSS 1|SK 1|bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1|sulfurylase kinase 1
Full Nomenclature : 3'-phosphoadenosine 5'-phosphosulfate synthase 1
GENEID : 9061
HGNC : 8603
MIM : 603262
Vega : OTTHUMG00000131210
Target GenBank: BC011392

 

Reference Sequence Alignment

  

HsCD00038039      ------------------------------------------------------------
NM_005443.4       ATGGAGATCCCCGGGAGCCTGTGCAAGAAAGTCAAACTGAGCAATAACGCGCAGAACTGG
                                                                              

HsCD00038039      ---ATGCAGAGAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGA
NM_005443.4       GGAATGCAGAGAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGA
                     *********************************************************

HsCD00038039      GGTCAGGTGGTGGGGACCAGAGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTG
NM_005443.4       GGTCAGGTGGTGGGGACCAGAGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTG
                  ************************************************************

HsCD00038039      TCTGGAGCGGGAAAGACTACTGTGAGCATGGCCTTGGAGGAGTACCTGGTTTGTCATGGT
NM_005443.4       TCTGGAGCGGGAAAGACTACTGTGAGCATGGCCTTGGAGGAGTACCTGGTTTGTCATGGT
                  ************************************************************

HsCD00038039      ATTCCATGCTACACTCTGGATGGTGACAATATTCGTCAAGGTCTCAATAAAAATCTTGGC
NM_005443.4       ATTCCATGCTACACTCTGGATGGTGACAATATTCGTCAAGGTCTCAATAAAAATCTTGGC
                  ************************************************************

HsCD00038039      TTTAGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGCTAAACTGTTT
NM_005443.4       TTTAGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGCTAAACTGTTT
                  ************************************************************

HsCD00038039      GCAGATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAAC
NM_005443.4       GCAGATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAAC
                  ************************************************************

HsCD00038039      AATGCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCT
NM_005443.4       AATGCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCT
                  ************************************************************

HsCD00038039      CCTCTGCATGTTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGA
NM_005443.4       CCTCTGCATGTTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGA
                  ************************************************************

HsCD00038039      GAAATTAAAGGTTTCACTGGGATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTG
NM_005443.4       GAAATTAAAGGTTTCACTGGGATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTG
                  ************************************************************

HsCD00038039      GTGCTGAAAACAGACTCCTGTGATGTAAATGACTGTGTCCAGCAAGTTGTGGAACTTCTA
NM_005443.4       GTGCTGAAAACAGACTCCTGTGATGTAAATGACTGTGTCCAGCAAGTTGTGGAACTTCTA
                  ************************************************************

HsCD00038039      CAGGAACGGGATATTGTACCTGTGGATGCATCTTATGAAGTAAAAGAACTATATGTGCCA
NM_005443.4       CAGGAACGGGATATTGTACCTGTGGATGCATCTTATGAAGTAAAAGAACTATATGTGCCA
                  ************************************************************

HsCD00038039      GAAAATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACTGAAAATTAAT
NM_005443.4       GAAAATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACTGAAAATTAAT
                  ************************************************************

HsCD00038039      AAAGTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGC
NM_005443.4       AAAGTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGC
                  ************************************************************

HsCD00038039      TTTATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGT
NM_005443.4       TTTATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGT
                  ************************************************************

HsCD00038039      GTCATTAACTTGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTG
NM_005443.4       GTCATTAACTTGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTG
                  ************************************************************

HsCD00038039      GACGGCTGTACAGCATTTGCTCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAAT
NM_005443.4       GACGGCTGTACAGCATTTGCTCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAAT
                  ************************************************************

HsCD00038039      CCAGAGTTTTTTGAGCACAGGAAAGAGGAGCGCTGTGCCAGACAGTGGGGAACGACATGC
NM_005443.4       CCAGAGTTTTTTGAGCACAGGAAAGAGGAGCGCTGTGCCAGACAGTGGGGAACGACATGC
                  ************************************************************

HsCD00038039      AAGAACCACCCCTATATTAAGATGGTGATGGAACAAGGAGATTGGCTGATTGGAGGAGAT
NM_005443.4       AAGAACCACCCCTATATTAAGATGGTGATGGAACAAGGAGATTGGCTGATTGGAGGAGAT
                  ************************************************************

HsCD00038039      CTTCAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCGTCTTACTCCT
NM_005443.4       CTTCAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCGTCTTACTCCT
                  ************************************************************

HsCD00038039      ACTGAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTA
NM_005443.4       ACTGAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTA
                  ************************************************************

HsCD00038039      CGCAACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTA
NM_005443.4       CGCAACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTA
                  ************************************************************

HsCD00038039      GAGAGGGGCTACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGAT
NM_005443.4       GAGAGGGGCTACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGAT
                  ************************************************************

HsCD00038039      GACGATGTTCCTTTGATGTGGCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTT
NM_005443.4       GACGATGTTCCTTTGATGTGGCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTT
                  ************************************************************

HsCD00038039      CTGAATCCTGAGACGACAGTGGTGGCCATCTTCCCATCTCCCATGATGTATGCTGGACCA
NM_005443.4       CTGAATCCTGAGACGACAGTGGTGGCCATCTTCCCATCTCCCATGATGTATGCTGGACCA
                  ************************************************************

HsCD00038039      ACTGAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAGGAGCCAACTTTTACATTGTT
NM_005443.4       ACTGAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAGGAGCCAACTTTTACATTGTT
                  ************************************************************

HsCD00038039      GGACGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTATGAGCCAAGT
NM_005443.4       GGACGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTATGAGCCAAGT
                  ************************************************************

HsCD00038039      CATGGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTT
NM_005443.4       CATGGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTT
                  ************************************************************

HsCD00038039      CGAGTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCAT
NM_005443.4       CGAGTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCAT
                  ************************************************************

HsCD00038039      GAAGACTTTGAATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAA
NM_005443.4       GAAGACTTTGAATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAA
                  ************************************************************

HsCD00038039      CCACCTGAAGGTTTCATGGCTCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCC
NM_005443.4       CCACCTGAAGGTTTCATGGCTCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCC
                  ************************************************************

HsCD00038039      TTGGAGAAAGCTTTG
NM_005443.4       TTGGAGAAAGCTTAG
                  *************:*

Pathways

Panther : Sulfate assimilation
Reactome : Biological oxidations
Reactome : Cytosolic sulfonation of small molecules
Reactome : Disease
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
Reactome : Phase II conjugation
Reactome : Transport and synthesis of PAPS
WikiPathway : Sulfation Biotransformation Reaction

Protein

UniProt : O43252
UniProt : Q6IAX6
HPRD : 09132

Clone

Cloning Information : 138609
HIP Master Clone ID : 87273
Original Clone ID : FLH138609.01L

Organism


TAX_ID : 9606
Species Specific ID: 9061

Genome

Chromosome : 4
Map Location : 4q24
Ensembl : ENSG00000138801

Reagents

Labome : PAPSS1-antibody