DNASU Plasmid Repository • 480.965.5697 | Email

TEK (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TEK
Gene Name:  TEK tyrosine kinase, endothelial
Sequence             
Original Clone ID: FLH181118.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038231

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3306nts         Open reading frame : 1 to 3306
Reference Sequence Alignment

ATGGACTTGATCTTGATCAATTCCCTACCTCTTGTATCTGATGCTGAAACATCTCTCACC
TGCATTGCCTCTGGGTGGCGCCCCCATGAGCCCATCACCATAGGAAGGGACTTTGAAGCC
TTAATGAACCAGCACCAGGATCCGCTGGAAGTTACTCAAGATGTGACCAGAGAATGGGCT
AAAAAAGTTGTTTGGAAGAGAGAAAAGGCTAGTAAGATCAATGGTGCTTATTTCTGTGAA
GGGCGAGTTCGAGGAGAGGCAATCAGGATACGAACCATGAAGATGCGTCAACAAGCTTCC
TTCCTACCAGCTACTTTAACTATGACTGTGGACAAGGGAGATAACGTGAACATATCTTTC
AAAAAGGTATTGATTAAAGAAGAAGATGCAGTGATTTACAAAAATGGTTCCTTCATCCAT
TCAGTGCCCCGGCATGAAGTACCTGATATTCTAGAAGTACACCTGCCTCATGCTCAGCCC
CAGGATGCTGGAGTGTACTCGGCCAGGTATATAGGAGGAAACCTCTTCACCTCGGCCTTC
ACCAGGCTGATAGTCCGGAGATGTGAAGCCCAGAAGTGGGGACCTGAATGCAACCATCTC
TGTACTGCTTGTATGAACAATGGTGTCTGCCATGAAGATACTGGAGAATGCATTTGCCCT
CCTGGGTTTATGGGAAGGACGTGTGAGAAGGCTTGTGAACTGCACACGTTTGGCAGAACT
TGTAAAGAAAGGTGCAGTGGACAAGAGGGATGCAAGTCTTATGTGTTCTGTCTCCCTGAC
CCCTATGGGTGTTCCTGTGCCACAGGCTGGAAGGGTCTGCAGTGCAATGAAGCATGCCAC
CCTGGTTTTTACGGGCCAGATTGTAAGCTTAGGTGCAGCTGCAACAATGGGGAGATGTGT
GATCGCTTCCAAGGATGTCTCTGCTCTCCAGGATGGCAGGGGCTCCAGTGTGAGAGAGAA
GGCATACCGAGGATGACCCCAAAGATAGTGGATTTGCCAGATCATATAGAAGTAAACAGT
GGTAAATTTAATCCCATTTGCAAAGCTTCTGGCTGGCCGCTACCTACTAATGAAGAAATG
ACCCTGGTGAAGCCGGATGGGACAGTGCTCCATCCAAAAGACTTTAACCATACGGATCAT
TTCTCAGTAGCCATATTCACCATCCACCGGATCCTCCCCCCTGACTCAGGAGTTTGGGTC
TGCAGTGTGAACACAGTGGCTGGGATGGTGGAAAAGCCCTTCAACATTTCTGTTAAAGTT
CTTCCAAAGCCCCTGAATGCCCCAAACGTGATTGACACTGGACATAACTTTGCTGTCATC
AACATCAGCTCTGAGCCTTACTTTGGGGATGGACCAATCAAATCCAAGAAGCTTCTATAC
AAACCCGTTAATCACTATGAGGCTTGGCAACATATTCAAGTGACAAATGAGATTGTTACA
CTCAACTATTTGGAACCTCGGACAGAATATGAACTCTGTGTGCAACTGGTCCGTCGTGGA
GAGGGTGGGGAAGGGCATCCTGGACCTGTGAGACGCTTCACAACAGCTTCTATCGGACTC
CCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAATTTGACCTGG
CAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGAAGGTCTGTG
CAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTGCTACTTAAC
AACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAGGCCCAGGGG
GAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCTCAACCAGAA
AACATCAAGATTTCCAACATTACACACTCCTCGGCTGTGATTTCTTGGACAATATTGGAT
GGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAATGAAGACCAG
CACGTTGATGTGAAGATAAAGAATGCCACCATCACTCAGTATCAGCTCAAGGGCCTAGAG
CCTGAAACAGCATACCAGGTGGACATTTTTGCAGAGAACAACATAGGGTCAAGCAACCCA
GCCTTTTCTCATGAACTGGTGACCCTCCCAGAATCTCAAGCACCAGCGGACCTCGGAGGG
GGGAAGATGCTGCTTATAGCCATCCTTGGCTCTGCTGGAATGACCTGCCTGACTGTGCTG
TTGGCCTTTCTGATCATATTGCAATTGAAGAGAGCAAATGTGCAAAGGAGAATGGCCCAA
GCCTTCCAAAACGTGAGGGAAGAACCAGCTGTGCAGTTCAACTCAGGGACTCTGGCCCTA
AACAGGAAGGTCAAAAACAACCCAGATCCTACAATTTATCCAGTGCTTGACTGGAATGAC
ATCAAATTTCAAGATGTGATTGGGGAGGGCAATTTTGGCCAAGTTCTTAAGGCGCGCATC
AAGAAGGATGGGTTACGGATGGATGCTGCCATCAAAAGAATGAAAGAATATGCCTCCAAA
GATGATCACAGGGACTTTGCAGGAGAACTGGAAGTTCTTTGTAAACTTGGACACCATCCA
AACATCATCAATCTCTTAGGAGCATGTGAACATCGAGGCTACTTGTACCTGGCCATTGAG
TACGCGCCCCATGGAAACCTTCTGGACTTCCTTCGCAAGAGCCGTGTGCTGGAGACGGAC
CCAGCATTTGCCATTGCCAATAGCACCGCGTCCACACTGTCCTCCCATCATCTCCTTCAC
TTCGCTGCCGACGTGGCCCGGGGCATGGACTACTTGAGCCAAAAACAGTTTATCCACAGG
GATCTGGCTGCCAGAAACATTTTAGTTGGTGAAAACTATGTGGCAAAAATAGCAGATTTT
GGATTGTCCCGAGGTCAAGAGGTGTATGTGAAAAAGACAATGGGAAGGCTCCCAGTGCGC
TGGATGGCCATCGAGTCACTGAATTACAGTGTGTACACAACCAACAGTGATGTATGGTCC
TATGGTGTGTTACTATGGGAGATTGTTAGCTTAGGAGGCACACCCTACTGCGGGATGACT
TGTGCAGAACTCTACGAGAAGCTGCCCCAGGGCTACAGACTGGAGAAGCCCCTGAACTGT
GATGATGAGGTGTATGATCTAATGAGACAATGCTGGCGGGAGAAGCCTTATGAGAGGCCA
TCATTTGCCCAGATATTGGTGTCCTTAAACAGAATGTTAGAGGAGCGAAAGACCTACGTG
AATACCACGCTTTATGAGAAGTTTACTTATGCAGGAATTGACTGTTCTGCTGAAGAAGCG
GCCTAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 3500
Start on reference sequence 195
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TEK
Symbol Nomenclature : TEK
SYNONYM : CD202B; TIE-2; TIE2; VMCM; VMCM1
Designation : angiopoietin-1 receptor|endothelial tyrosine kinase|hTIE2|p140 TEK|soluble TIE2 variant 1|soluble TIE2 variant 2|tunica interna endothelial cell kinase|tyrosine kinase with Ig and EGF homology domains-2|tyrosine-protein kinase receptor TEK|tyrosine-protein kinase receptor TIE-2
Full Nomenclature : TEK tyrosine kinase, endothelial
GENEID : 7010
HGNC : 11724
MIM : 600221
Vega : OTTHUMG00000019712
Target GenBank: BC035514

 

Reference Sequence Alignment

  

HsCD00038231        ------------------------------------------------------------
XM_005251562.1      ATGGACTCTTTAGCCAGCTTAGTTCTCTGTGGAGTCAGCTTGCTCCTTTCTGGAACTGTG
XM_005251561.1      ATGGACTCTTTAGCCAGCTTAGTTCTCTGTGGAGTCAGCTTGCTCCTTTCTGGAACTGTG
                                                                                

HsCD00038231        ---------ATGGACTTGATCTTGATCAATTCCCTACCTCTTGTATCTGATGCTGAAACA
XM_005251562.1      GAAGGTGCCATGGACTTGATCTTGATCAATTCCCTACCTCTTGTATCTGATGCTGAAACA
XM_005251561.1      GAAGGTGCCATGGACTTGATCTTGATCAATTCCCTACCTCTTGTATCTGATGCTGAAACA
                             ***************************************************

HsCD00038231        TCTCTCACCTGCATTGCCTCTGGGTGGCGCCCCCATGAGCCCATCACCATAGGAAGGGAC
XM_005251562.1      TCTCTCACCTGCATTGCCTCTGGGTGGCGCCCCCATGAGCCCATCACCATAGGAAGGGAC
XM_005251561.1      TCTCTCACCTGCATTGCCTCTGGGTGGCGCCCCCATGAGCCCATCACCATAGGAAGGGAC
                    ************************************************************

HsCD00038231        TTTGAAGCCTTAATGAACCAGCACCAGGATCCGCTGGAAGTTACTCAAGATGTGACCAGA
XM_005251562.1      TTTGAAGCCTTAATGAACCAGCACCAGGATCCGCTGGAAGTTACTCAAGATGTGACCAGA
XM_005251561.1      TTTGAAGCCTTAATGAACCAGCACCAGGATCCGCTGGAAGTTACTCAAGATGTGACCAGA
                    ************************************************************

HsCD00038231        GAATGGGCTAAAAAAGTTGTTTGGAAGAGAGAAAAGGCTAGTAAGATCAATGGTGCTTAT
XM_005251562.1      GAATGGGCTAAAAAAGTTGTTTGGAAGAGAGAAAAGGCTAGTAAGATCAATGGTGCTTAT
XM_005251561.1      GAATGGGCTAAAAAAGTTGTTTGGAAGAGAGAAAAGGCTAGTAAGATCAATGGTGCTTAT
                    ************************************************************

HsCD00038231        TTCTGTGAAGGGCGAGTTCGAGGAGAGGCAATCAGGATACGAACCATGAAGATGCGTCAA
XM_005251562.1      TTCTGTGAAGGGCGAGTTCGAGGAGAGGCAATCAGGATACGAACCATGAAGATGCGTCAA
XM_005251561.1      TTCTGTGAAGGGCGAGTTCGAGGAGAGGCAATCAGGATACGAACCATGAAGATGCGTCAA
                    ************************************************************

HsCD00038231        CAAGCTTCCTTCCTACCAGCTACTTTAACTATGACTGTGGACAAGGGAGATAACGTGAAC
XM_005251562.1      CAAGCTTCCTTCCTACCAGCTACTTTAACTATGACTGTGGACAAGGGAGATAACGTGAAC
XM_005251561.1      CAAGCTTCCTTCCTACCAGCTACTTTAACTATGACTGTGGACAAGGGAGATAACGTGAAC
                    ************************************************************

HsCD00038231        ATATCTTTCAAAAAGGTATTGATTAAAGAAGAAGATGCAGTGATTTACAAAAATGGTTCC
XM_005251562.1      ATATCTTTCAAAAAGGTATTGATTAAAGAAGAAGATGCAGTGATTTACAAAAATGGTTCC
XM_005251561.1      ATATCTTTCAAAAAGGTATTGATTAAAGAAGAAGATGCAGTGATTTACAAAAATGGTTCC
                    ************************************************************

HsCD00038231        TTCATCCATTCAGTGCCCCGGCATGAAGTACCTGATATTCTAGAAGTACACCTGCCTCAT
XM_005251562.1      TTCATCCATTCAGTGCCCCGGCATGAAGTACCTGATATTCTAGAAGTACACCTGCCTCAT
XM_005251561.1      TTCATCCATTCAGTGCCCCGGCATGAAGTACCTGATATTCTAGAAGTACACCTGCCTCAT
                    ************************************************************

HsCD00038231        GCTCAGCCCCAGGATGCTGGAGTGTACTCGGCCAGGTATATAGGAGGAAACCTCTTCACC
XM_005251562.1      GCTCAGCCCCAGGATGCTGGAGTGTACTCGGCCAGGTATATAGGAGGAAACCTCTTCACC
XM_005251561.1      GCTCAGCCCCAGGATGCTGGAGTGTACTCGGCCAGGTATATAGGAGGAAACCTCTTCACC
                    ************************************************************

HsCD00038231        TCGGCCTTCACCAGGCTGATAGTCCGGAGATGTGAAGCCCAGAAGTGGGGACCTGAATGC
XM_005251562.1      TCGGCCTTCACCAGGCTGATAGTCCGGAGATGTGAAGCCCAGAAGTGGGGACCTGAATGC
XM_005251561.1      TCGGCCTTCACCAGGCTGATAGTCCGGAGATGTGAAGCCCAGAAGTGGGGACCTGAATGC
                    ************************************************************

HsCD00038231        AACCATCTCTGTACTGCTTGTATGAACAATGGTGTCTGCCATGAAGATACTGGAGAATGC
XM_005251562.1      AACCATCTCTGTACTGCTTGTATGAACAATGGTGTCTGCCATGAAGATACTGGAGAATGC
XM_005251561.1      AACCATCTCTGTACTGCTTGTATGAACAATGGTGTCTGCCATGAAGATACTGGAGAATGC
                    ************************************************************

HsCD00038231        ATTTGCCCTCCTGGGTTTATGGGAAGGACGTGTGAGAAGGCTTGTGAACTGCACACGTTT
XM_005251562.1      ATTTGCCCTCCTGGGTTTATGGGAAGGACGTGTGAGAAGGCTTGTGAACTGCACACGTTT
XM_005251561.1      ATTTGCCCTCCTGGGTTTATGGGAAGGACGTGTGAGAAGGCTTGTGAACTGCACACGTTT
                    ************************************************************

HsCD00038231        GGCAGAACTTGTAAAGAAAGGTGCAGTGGACAAGAGGGATGCAAGTCTTATGTGTTCTGT
XM_005251562.1      GGCAGAACTTGTAAAGAAAGGTGCAGTGGACAAGAGGGATGCAAGTCTTATGTGTTCTGT
XM_005251561.1      GGCAGAACTTGTAAAGAAAGGTGCAGTGGACAAGAGGGATGCAAGTCTTATGTGTTCTGT
                    ************************************************************

HsCD00038231        CTCCCTGACCCCTATGGGTGTTCCTGTGCCACAGGCTGGAAGGGTCTGCAGTGCAATGAA
XM_005251562.1      CTCCCTGACCCCTATGGGTGTTCCTGTGCCACAGGCTGGAAGGGTCTGCAGTGCAAT---
XM_005251561.1      CTCCCTGACCCCTATGGGTGTTCCTGTGCCACAGGCTGGAAGGGTCTGCAGTGCAATGAA
                    *********************************************************   

HsCD00038231        GCATGCCACCCTGGTTTTTACGGGCCAGATTGTAAGCTTAGGTGCAGCTGCAACAATGGG
XM_005251562.1      ------------------------------------------------------------
XM_005251561.1      GCATGCCACCCTGGTTTTTACGGGCCAGATTGTAAGCTTAGGTGCAGCTGCAACAATGGG
                                                                                

HsCD00038231        GAGATGTGTGATCGCTTCCAAGGATGTCTCTGCTCTCCAGGATGGCAGGGGCTCCAGTGT
XM_005251562.1      ------------------------------------------------------------
XM_005251561.1      GAGATGTGTGATCGCTTCCAAGGATGTCTCTGCTCTCCAGGATGGCAGGGGCTCCAGTGT
                                                                                

HsCD00038231        GAGAGAGAAGGCATACCGAGGATGACCCCAAAGATAGTGGATTTGCCAGATCATATAGAA
XM_005251562.1      ------GAAGGCATACAGAGGATGACCCCAAAGATAGTGGATTTGCCAGATCATATAGAA
XM_005251561.1      GAGAGAGAAGGCATACAGAGGATGACCCCAAAGATAGTGGATTTGCCAGATCATATAGAA
                          **********.*******************************************

HsCD00038231        GTAAACAGTGGTAAATTTAATCCCATTTGCAAAGCTTCTGGCTGGCCGCTACCTACTAAT
XM_005251562.1      GTAAACAGTGGTAAATTTAATCCCATTTGCAAAGCTTCTGGCTGGCCGCTACCTACTAAT
XM_005251561.1      GTAAACAGTGGTAAATTTAATCCCATTTGCAAAGCTTCTGGCTGGCCGCTACCTACTAAT
                    ************************************************************

HsCD00038231        GAAGAAATGACCCTGGTGAAGCCGGATGGGACAGTGCTCCATCCAAAAGACTTTAACCAT
XM_005251562.1      GAAGAAATGACCCTGGTGAAGCCGGATGGGACAGTGCTCCATCCAAAAGACTTTAACCAT
XM_005251561.1      GAAGAAATGACCCTGGTGAAGCCGGATGGGACAGTGCTCCATCCAAAAGACTTTAACCAT
                    ************************************************************

HsCD00038231        ACGGATCATTTCTCAGTAGCCATATTCACCATCCACCGGATCCTCCCCCCTGACTCAGGA
XM_005251562.1      ACGGATCATTTCTCAGTAGCCATATTCACCATCCACCGGATCCTCCCCCCTGACTCAGGA
XM_005251561.1      ACGGATCATTTCTCAGTAGCCATATTCACCATCCACCGGATCCTCCCCCCTGACTCAGGA
                    ************************************************************

HsCD00038231        GTTTGGGTCTGCAGTGTGAACACAGTGGCTGGGATGGTGGAAAAGCCCTTCAACATTTCT
XM_005251562.1      GTTTGGGTCTGCAGTGTGAACACAGTGGCTGGGATGGTGGAAAAGCCCTTCAACATTTCT
XM_005251561.1      GTTTGGGTCTGCAGTGTGAACACAGTGGCTGGGATGGTGGAAAAGCCCTTCAACATTTCT
                    ************************************************************

HsCD00038231        GTTAAAGTTCTTCCAAAGCCCCTGAATGCCCCAAACGTGATTGACACTGGACATAACTTT
XM_005251562.1      GTTAAAGTTCTTCCAAAGCCCCTGAATGCCCCAAACGTGATTGACACTGGACATAACTTT
XM_005251561.1      GTTAAAGTTCTTCCAAAGCCCCTGAATGCCCCAAACGTGATTGACACTGGACATAACTTT
                    ************************************************************

HsCD00038231        GCTGTCATCAACATCAGCTCTGAGCCTTACTTTGGGGATGGACCAATCAAATCCAAGAAG
XM_005251562.1      GCTGTCATCAACATCAGCTCTGAGCCTTACTTTGGGGATGGACCAATCAAATCCAAGAAG
XM_005251561.1      GCTGTCATCAACATCAGCTCTGAGCCTTACTTTGGGGATGGACCAATCAAATCCAAGAAG
                    ************************************************************

HsCD00038231        CTTCTATACAAACCCGTTAATCACTATGAGGCTTGGCAACATATTCAAGTGACAAATGAG
XM_005251562.1      CTTCTATACAAACCCGTTAATCACTATGAGGCTTGGCAACATATTCAAGTGACAAATGAG
XM_005251561.1      CTTCTATACAAACCCGTTAATCACTATGAGGCTTGGCAACATATTCAAGTGACAAATGAG
                    ************************************************************

HsCD00038231        ATTGTTACACTCAACTATTTGGAACCTCGGACAGAATATGAACTCTGTGTGCAACTGGTC
XM_005251562.1      ATTGTTACACTCAACTATTTGGAACCTCGGACAGAATATGAACTCTGTGTGCAACTGGTC
XM_005251561.1      ATTGTTACACTCAACTATTTGGAACCTCGGACAGAATATGAACTCTGTGTGCAACTGGTC
                    ************************************************************

HsCD00038231        CGTCGTGGAGAGGGTGGGGAAGGGCATCCTGGACCTGTGAGACGCTTCACAACAGCTTCT
XM_005251562.1      CGTCGTGGAGAGGGTGGGGAAGGGCATCCTGGACCTGTGAGACGCTTCACAACAGCTTCT
XM_005251561.1      CGTCGTGGAGAGGGTGGGGAAGGGCATCCTGGACCTGTGAGACGCTTCACAACAGCTTCT
                    ************************************************************

HsCD00038231        ATCGGACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAAT
XM_005251562.1      ATCGGACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAAT
XM_005251561.1      ATCGGACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAAT
                    ************************************************************

HsCD00038231        TTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGA
XM_005251562.1      TTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGA
XM_005251561.1      TTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGA
                    ************************************************************

HsCD00038231        AGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTG
XM_005251562.1      AGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTG
XM_005251561.1      AGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTG
                    ************************************************************

HsCD00038231        CTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAG
XM_005251562.1      CTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAG
XM_005251561.1      CTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAG
                    ************************************************************

HsCD00038231        GCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCT
XM_005251562.1      GCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCT
XM_005251561.1      GCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCT
                    ************************************************************

HsCD00038231        CAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCGGCTGTGATTTCTTGGACA
XM_005251562.1      CAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCAGCTGTGATTTCTTGGACA
XM_005251561.1      CAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCAGCTGTGATTTCTTGGACA
                    *****************************************.******************

HsCD00038231        ATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAAT
XM_005251562.1      ATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAAT
XM_005251561.1      ATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAAT
                    ************************************************************

HsCD00038231        GAAGACCAGCACGTTGATGTGAAGATAAAGAATGCCACCATCACTCAGTATCAGCTCAAG
XM_005251562.1      GAAGACCAGCACGTTGATGTGAAGATAAAGAATGCCACCATCACTCAGTATCAGCTCAAG
XM_005251561.1      GAAGACCAGCACGTTGATGTGAAGATAAAGAATGCCACCATCACTCAGTATCAGCTCAAG
                    ************************************************************

HsCD00038231        GGCCTAGAGCCTGAAACAGCATACCAGGTGGACATTTTTGCAGAGAACAACATAGGGTCA
XM_005251562.1      GGCCTAGAGCCTGAAACAGCATACCAGGTGGACATTTTTGCAGAGAACAACATAGGGTCA
XM_005251561.1      GGCCTAGAGCCTGAAACAGCATACCAGGTGGACATTTTTGCAGAGAACAACATAGGGTCA
                    ************************************************************

HsCD00038231        AGCAACCCAGCCTTTTCTCATGAACTGGTGACCCTCCCAGAATCTCAAGCACCAGCGGAC
XM_005251562.1      AGCAACCCAGCCTTTTCTCATGAACTGGTGACCCTCCCAGAATCTCAAGCACCAGCGGAC
XM_005251561.1      AGCAACCCAGCCTTTTCTCATGAACTGGTGACCCTCCCAGAATCTCAAGCACCAGCGGAC
                    ************************************************************

HsCD00038231        CTCGGAGGGGGGAAGATGCTGCTTATAGCCATCCTTGGCTCTGCTGGAATGACCTGCCTG
XM_005251562.1      CTCGGAGGGGGGAAGATGCTGCTTATAGCCATCCTTGGCTCTGCTGGAATGACCTGCCTG
XM_005251561.1      CTCGGAGGGGGGAAGATGCTGCTTATAGCCATCCTTGGCTCTGCTGGAATGACCTGCCTG
                    ************************************************************

HsCD00038231        ACTGTGCTGTTGGCCTTTCTGATCATATTGCAATTGAAGAGAGCAAATGTGCAAAGGAGA
XM_005251562.1      ACTGTGCTGTTGGCCTTTCTGATCATATTGCAATTGAAGAGGGCAAATGTGCAAAGGAGA
XM_005251561.1      ACTGTGCTGTTGGCCTTTCTGATCATATTGCAATTGAAGAGGGCAAATGTGCAAAGGAGA
                    *****************************************.******************

HsCD00038231        ATGGCCCAAGCCTTCCAAAACGTGAGGGAAGAACCAGCTGTGCAGTTCAACTCAGGGACT
XM_005251562.1      ATGGCCCAAGCCTTCCAAAACGTGAGGGAAGAACCAGCTGTGCAGTTCAACTCAGGGACT
XM_005251561.1      ATGGCCCAAGCCTTCCAAAACAG---GGAAGAACCAGCTGTGCAGTTCAACTCAGGGACT
                    *********************.    **********************************

HsCD00038231        CTGGCCCTAAACAGGAAGGTCAAAAACAACCCAGATCCTACAATTTATCCAGTGCTTGAC
XM_005251562.1      CTGGCCCTAAACAGGAAGGTCAAAAACAACCCAGATCCTACAATTTATCCAGTGCTTGAC
XM_005251561.1      CTGGCCCTAAACAGGAAGGTCAAAAACAACCCAGATCCTACAATTTATCCAGTGCTTGAC
                    ************************************************************

HsCD00038231        TGGAATGACATCAAATTTCAAGATGTGATTGGGGAGGGCAATTTTGGCCAAGTTCTTAAG
XM_005251562.1      TGGAATGACATCAAATTTCAAGATGTGATTGGGGAGGGCAATTTTGGCCAAGTTCTTAAG
XM_005251561.1      TGGAATGACATCAAATTTCAAGATGTGATTGGGGAGGGCAATTTTGGCCAAGTTCTTAAG
                    ************************************************************

HsCD00038231        GCGCGCATCAAGAAGGATGGGTTACGGATGGATGCTGCCATCAAAAGAATGAAAGAATAT
XM_005251562.1      GCGCGCATCAAGAAGGATGGGTTACGGATGGATGCTGCCATCAAAAGAATGAAAGAATAT
XM_005251561.1      GCGCGCATCAAGAAGGATGGGTTACGGATGGATGCTGCCATCAAAAGAATGAAAGAATAT
                    ************************************************************

HsCD00038231        GCCTCCAAAGATGATCACAGGGACTTTGCAGGAGAACTGGAAGTTCTTTGTAAACTTGGA
XM_005251562.1      GCCTCCAAAGATGATCACAGGGACTTTGCAGGAGAACTGGAAGTTCTTTGTAAACTTGGA
XM_005251561.1      GCCTCCAAAGATGATCACAGGGACTTTGCAGGAGAACTGGAAGTTCTTTGTAAACTTGGA
                    ************************************************************

HsCD00038231        CACCATCCAAACATCATCAATCTCTTAGGAGCATGTGAACATCGAGGCTACTTGTACCTG
XM_005251562.1      CACCATCCAAACATCATCAATCTCTTAGGAGCATGTGAACATCGAGGCTACTTGTACCTG
XM_005251561.1      CACCATCCAAACATCATCAATCTCTTAGGAGCATGTGAACATCGAGGCTACTTGTACCTG
                    ************************************************************

HsCD00038231        GCCATTGAGTACGCGCCCCATGGAAACCTTCTGGACTTCCTTCGCAAGAGCCGTGTGCTG
XM_005251562.1      GCCATTGAGTACGCGCCCCATGGAAACCTTCTGGACTTCCTTCGCAAGAGCCGTGTGCTG
XM_005251561.1      GCCATTGAGTACGCGCCCCATGGAAACCTTCTGGACTTCCTTCGCAAGAGCCGTGTGCTG
                    ************************************************************

HsCD00038231        GAGACGGACCCAGCATTTGCCATTGCCAATAGCACCGCGTCCACACTGTCCTCCCATCAT
XM_005251562.1      GAGACGGACCCAGCATTTGCCATTGCCAATAGCACCGCGTCCACACTGTCCTCCCAGCAG
XM_005251561.1      GAGACGGACCCAGCATTTGCCATTGCCAATAGCACCGCGTCCACACTGTCCTCCCAGCAG
                    ******************************************************** ** 

HsCD00038231        CTCCTTCACTTCGCTGCCGACGTGGCCCGGGGCATGGACTACTTGAGCCAAAAACAGTTT
XM_005251562.1      CTCCTTCACTTCGCTGCCGACGTGGCCCGGGGCATGGACTACTTGAGCCAAAAACAGTTT
XM_005251561.1      CTCCTTCACTTCGCTGCCGACGTGGCCCGGGGCATGGACTACTTGAGCCAAAAACAGTTT
                    ************************************************************

HsCD00038231        ATCCACAGGGATCTGGCTGCCAGAAACATTTTAGTTGGTGAAAACTATGTGGCAAAAATA
XM_005251562.1      ATCCACAGGGATCTGGCTGCCAGAAACATTTTAGTTGGTGAAAACTATGTGGCAAAAATA
XM_005251561.1      ATCCACAGGGATCTGGCTGCCAGAAACATTTTAGTTGGTGAAAACTATGTGGCAAAAATA
                    ************************************************************

HsCD00038231        GCAGATTTTGGATTGTCCCGAGGTCAAGAGGTGTATGTGAAAAAGACAATGGGAAGGCTC
XM_005251562.1      GCAGATTTTGGATTGTCCCGAGGTCAAGAGGTGTATGTGAAAAAGACAATGGGAAGGCTC
XM_005251561.1      GCAGATTTTGGATTGTCCCGAGGTCAAGAGGTGTATGTGAAAAAGACAATGGGAAGGCTC
                    ************************************************************

HsCD00038231        CCAGTGCGCTGGATGGCCATCGAGTCACTGAATTACAGTGTGTACACAACCAACAGTGAT
XM_005251562.1      CCAGTGCGCTGGATGGCCATCGAGTCACTGAATTACAGTGTGTACACAACCAACAGTGAT
XM_005251561.1      CCAGTGCGCTGGATGGCCATCGAGTCACTGAATTACAGTGTGTACACAACCAACAGTGAT
                    ************************************************************

HsCD00038231        GTATGGTCCTATGGTGTGTTACTATGGGAGATTGTTAGCTTAGGAGGCACACCCTACTGC
XM_005251562.1      GTATGGTCCTATGGTGTGTTACTATGGGAGATTGTTAGCTTAGGAGGCACACCCTACTGC
XM_005251561.1      GTATGGTCCTATGGTGTGTTACTATGGGAGATTGTTAGCTTAGGAGGCACACCCTACTGC
                    ************************************************************

HsCD00038231        GGGATGACTTGTGCAGAACTCTACGAGAAGCTGCCCCAGGGCTACAGACTGGAGAAGCCC
XM_005251562.1      GGGATGACTTGTGCAGAACTCTACGAGAAGCTGCCCCAGGGCTACAGACTGGAGAAGCCC
XM_005251561.1      GGGATGACTTGTGCAGAACTCTACGAGAAGCTGCCCCAGGGCTACAGACTGGAGAAGCCC
                    ************************************************************

HsCD00038231        CTGAACTGTGATGATGAGGTGTATGATCTAATGAGACAATGCTGGCGGGAGAAGCCTTAT
XM_005251562.1      CTGAACTGTGATGATGAGGTGTATGATCTAATGAGACAATGCTGGCGGGAGAAGCCTTAT
XM_005251561.1      CTGAACTGTGATGATGAGGTGTATGATCTAATGAGACAATGCTGGCGGGAGAAGCCTTAT
                    ************************************************************

HsCD00038231        GAGAGGCCATCATTTGCCCAGATATTGGTGTCCTTAAACAGAATGTTAGAGGAGCGAAAG
XM_005251562.1      GAGAGGCCATCATTTGCCCAGATATTGGTGTCCTTAAACAGAATGTTAGAGGAGCGAAAG
XM_005251561.1      GAGAGGCCATCATTTGCCCAGATATTGGTGTCCTTAAACAGAATGTTAGAGGAGCGAAAG
                    ************************************************************

HsCD00038231        ACCTACGTGAATACCACGCTTTATGAGAAGTTTACTTATGCAGGAATTGACTGTTCTGCT
XM_005251562.1      ACCTACGTGAATACCACGCTTTATGAGAAGTTTACTTATGCAGGAATTGACTGTTCTGCT
XM_005251561.1      ACCTACGTGAATACCACGCTTTATGAGAAGTTTACTTATGCAGGAATTGACTGTTCTGCT
                    ************************************************************

HsCD00038231        GAAGAAGCGGCCTAG
XM_005251562.1      GAAGAAGCGGCCTAG
XM_005251561.1      GAAGAAGCGGCCTAG
                    ***************

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : SHP2 signaling
Panther : Angiogenesis
Reactome : Cell surface interactions at the vascular wall
Reactome : Hemostasis
Reactome : Tie2 Signaling
WikiPathway : Angiogenesis
WikiPathway : Wnt Signaling Pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 181118
HIP Master Clone ID : 95684
Original Clone ID : FLH181118.01X

Organism


TAX_ID : 9606
Species Specific ID: 7010

Genome

Chromosome : 9
Map Location : 9p21
Ensembl : ENSG00000120156

Reagents

Labome : tie-2-antibody