DNASU Plasmid Repository • 480.965.5697 | Email

TM0228 (Thermotoga maritima) in pMH2T7 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TM0228
Gene Name:  NADP-reducing hydrogenase, subunit C
Sequence             
Original Clone ID: 8066
Keyword: full-length cds
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH2T7               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
TmCD00382456

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1638nts         Open reading frame : 51 to 1688

GAGATATACATACCCATGGGATCTGATAAAATTCATCATCATCATCATCAATGAAACCGA
TAACAGTTCTGGTTTCGGTGGATTCAAACAGTGTGTTGATGGGTGCTCGTCACTTTCTCA
ATTACTTCAGAGATCTTGTGAAGGAACACAATCTCGAAGATACCGTCGATGTGCTGGAAA
CGGGCAGCATGGGAATTTATCCAGAAGGAGTGATTGTTTCCGTTCTTCCCGACGGTGTTT
TCTACGTTGTGAGGAATGAATTGGATGTGAGGAGGATCTTCGAAGAGCACATTCTCAAGG
GAAGGAGAGTGCTCGATCTTGAAATTCCCGAGAGTCAAATAAAAGGAACCGTTGAGGTAG
AGAAGGTGGCCGAAGAAACTCGTATCGTTCTAAAGAACGTAGGAGAGATAGATCCCACTC
GTATAGAGGAATACATCGCAAGAGACGGTTACTTTGCCCTCGCCAAGGCGCTCCAGATGG
AACCAGGAGAGATAATCGAAGAGATAAAGCGAAGTGGGCTGAGAGGAAGAGGTGGAGCCG
GTTTTCCAACGGGTCTGAAATGGGAATTCACCTACAAAGCTTCTGCCGACCAGAAATATG
TTCTGTGCAACGCCGATGAAGGAGAGCCCGGTACCTTTAAAGACAGGCTCATCATGGAGG
GTGATCCTCATTCTTTGATAGAGGGCATGATCATAGCGGGGTACGCGGTTGGTGCAACGA
AGGGTTACATATACATAAGGGGAGAGTATCACAGTTCGATAGAAATCTTGAAAAAAGCTG
TAGAACAGGCCTACGAGTACGGATTCCTCGGTGAGAACATCCTCGGAAGTGGATTCAACT
TCGATCTGAAAATAAGGCTCGGGGCGGGAGCTTACGTGGCGGGAGAGGAGACGGCGTTGA
TAGAGTCCATAGAGGGGAAACCCGCTCGACCCAGGCTGAAACCTCCTTACCCTCCCACTT
TTGGCCTCTTTGGAAAACCCACCGTTGTGAACAACGTGGAAACTTTTGTGAACGTTCCAA
GGATAATAATGAACGGTGCGGAGTGGTTCAAAAAGTTCGGCACCGAGTCTTCTCCTGGGA
CGAAAGTGTTCTCCCTCGTGGGTAATGTGGTGAGAAAGGGAATCGTGGAAGTGCCAATGG
GAGTGACGGTGAGAGATCTCATTTTCAAATTTGGTGGGGGGATTGAGGGTGGCAGGAAGT
TGAAAGTGGTGCAAACGGGTGGTAGTGCAGGAACGTTCATCGGACCAGACAAACTCGACG
TTCCACTCGATTTTGATTCTTACGCAAAGTACGGAGTTTCTCTCGGATCAGGAGTGATTC
TCGTTGCTGACGAGACTCACTGTGTGGTGGATCTCGCACTCACCGTTATGAGGTTCTTCG
AACACGAGTCGTGTGGGAAGTGTACACCGTGTCGGGAAGGTACGAGGATGATCGTCAATA
TTTTGGAGAGAATAAGCAGAGGAGAAGGCAAAAAAGAGGATCTCGATACGTTGAGGGAGA
TTGCTCGAAACGCGGGGGAAACTTCTTTCTGCGGACTGGGTCAAAGCATTCCGGTTCCTC
TGCTCTCCATCGTTGACAACTTCGAGGAAGAGTTCAAAGCCCACATAGGTGCTGATAAAT
GTCCAGTGGGTGTGTGTGAGTTCAAGAAGAAGAAGGAAAAGAAGAAAATTGGTGTTAGAA
AACCATAATTAATTAACTTTAAGAAGGAGATATACATACCCGGGTAAGTTTAAACGGTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Protein_Purified
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in 282107
Recommended expression in: DL41
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH2T7

pMH2T7 in advanced viewed

Synonyms: pMH-2-T7
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial (E. coli) expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enzyme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 4084
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColEI origin of replication 1921 2603
promoter T7 T7 promoter 290 310
promoter araC araC promoter 256 285
selectable marker AmpR ampicillin resistance gene 1164 1823
tag His N-terminal 6x His tag 367 381
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : TM0228
GENEID : 897127
Locus Tag : TM0228
GI : 15643000
GenBank Accession : AAD35319
Target GenBank: NP_228042

 

Clone

Cloning Information : 276335
HIP Master Clone ID : 205821
Original Clone ID : 8066

Experimental

TargetTrack - Experimental data : 282107

Organism


TAX_ID : 243274
Species Specific ID: 897127

Reagents

Labome : TM0228-cDNA