DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  ATM
Gene Name:  ataxia telangiectasia mutated
Original Clone ID: FLH204932.01L
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 417nts         Open reading frame : 1 to 417
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 490
Start on reference sequence 74
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : ATM
Symbol Nomenclature : ATM
Designation : A-T mutated|AT mutated|TEL1, telomere maintenance 1, homolog|serine-protein kinase ATM
Full Nomenclature : ataxia telangiectasia mutated
GENEID : 472
HGNC : 795
MIM : 607585
Vega : OTTHUMG00000166480
Target GenBank: BC007023


Reference Sequence Alignment


HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT







HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------GAAATTAACCATTTTCTCTCAGTT

HsCD00038270      G-----------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ------------------------------------------------------------

HsCD00038270      ---------------------------------------------------


NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR


UniProt : Q13315
HPRD : 06347


Cloning Information : 204932
HIP Master Clone ID : 57092
Original Clone ID : FLH204932.01L


TAX_ID : 9606
Species Specific ID: 472


Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000149311


Labome : ATM-antibody