DNASU Plasmid Repository • 480.965.5697 | Email

EGFR (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  EGFR
Gene Name:  epidermal growth factor receptor
Original Clone ID: FLH204958.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: Site-specific mutagenesis derived of HIP clone; mutation designed to result in disease related variant
Discrepancy :
Yes / Yes
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 3633nts         Open reading frame : 1 to 3633
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 3879
Start on reference sequence 247


5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : EGFR
Symbol Nomenclature : EGFR
Designation : avian erythroblastic leukemia viral (v-erb-b) oncogene homolog|cell growth inhibiting protein 40|cell proliferation-inducing protein 61|proto-oncogene c-ErbB-1|receptor tyrosine-protein kinase erbB-1
Full Nomenclature : epidermal growth factor receptor
GENEID : 1956
HGNC : 3236
MIM : 131550
Vega : OTTHUMG00000023661
Target GenBank: NM_005228


Reference Sequence Alignment












































                  **************************************************** *******


















                  ******************************* .


NCI : Arf6 signaling events
NCI : Direct p53 effectors
NCI : E-cadherin signaling in keratinocytes
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EGFR-dependent Endothelin signaling events
NCI : ErbB receptor signaling network
NCI : ErbB1 downstream signaling
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Regulation of Telomerase
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
NCI : Stabilization and expansion of the E-cadherin adherens junction
NCI : Syndecan-3-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : a6b1 and a6b4 Integrin signaling
Panther : Cadherin signaling pathway
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : EGFR downregulation
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : L1CAM interactions
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Androgen receptor signaling pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of Actin Cytoskeleton


Cloning Information : 204958
HIP Master Clone ID : 178308
Original Clone ID : FLH204958.01L


TAX_ID : 9606
Species Specific ID: 1956


Chromosome : 7
Map Location : 7p12
Ensembl : ENSG00000146648


Labome : EGFR-antibody