DNASU Plasmid Repository • 480.965.5697 | Email

EMS1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CTTN
Gene Name:  cortactin
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH027816.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003834

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1542nts         Open reading frame : 1 to 1542
Reference Sequence Alignment

ATGTGGAAAGCTTCAGCAGGCCACGCTGTGTCCATCGCCCAGGATGACGCGGGGGCCGAT
GACTGGGAGACCGACCCTGATTTTGTGAATGATGTGAGTGAGAAGGAGCAAAGATGGGGT
GCCAAGACGGTGCAGGGCTCCGGGCACCAGGAGCATATCAACATACACAAGCTGAGGGAG
AATGTCTTTCAAGAGCATCAGACCCTTAAGGAGAAGGAACTTGAAACAGGACCAAAAGCT
TCCCATGGCTATGGAGGGAAATTTGGTGTGGAACAAGACCGAATGGATAAGTCAGCTGTC
GGCCACGAATATCAGTCGAAACTTTCCAAGCACTGCTCGCAGGTGGACTCGGTCCGTGGC
TTCGGAGGCAAGTTTGGTGTCCAGATGGACAGAGTTGATCAGTCTGCTGTAGGCTTTGAA
TACCAGGGGAAGACTGAGAAGCATGCCTCCCAGAAAGACTACTCCAGTGGTTTTGGCGGC
AAGTATGGCGTGCAGGCCGACCGAGTAGACAAGAGCGCGGTGGGCTTCGACTACCAGGGC
AAGACGGAGAAGCACGAGTCACAGAGAGATTACTCCAAAGGTTTCGGCGGCAAATACGGT
ATCGACAAGGACAAAGTGGATAAGAGCGCCGTTGGCTTTGAGTATCAAGGCAAAACGGAG
AAGCACGAGTCCCAGAAAGACTATGTGAAAGGGTTTGGAGGAAAATTTGGTGTGCAGACA
GACAGACAAGACAAATGTGCCCTTGGCTGGGATCACCAGGAGAAATTGCAGCTGCATGAA
TCCCAAAAAGACTACTCCAAAGGATTCGGCGGGAAGTATGGGGTGCAGAAGGATCGGATG
GATAAGAATGCGTCAACCTTTGAGGATGTCACCCAGGTGTCCTCTGCCTACCAGAAGACA
GTACCTGTCGAAGCTGTGACCAGCAAAACAAGTAACATCAGAGCTAACTTTGAAAACCTC
GCTAAGGAGAAAGAGCAGGAGGACAGGCGGAAGGCGGAGGCGGAGAGAGCCCAGCGGATG
GCCAAGGAGCGGCAGGAGCAGGAAGAGGCCAGGAGGAAGCTGGAGGAGCAAGCCAGAGCC
AAAACGCAAACGCCCCCTGTGTCGCCCGCACCTCAGCCAACCGAGGAGAGGCTGCCCTCG
AGCCCCGTCTATGAGGATGCGGCTTCCTTCAAGGCAGAGCTGAGCTACAGAGGCCCTGTG
AGTGGGACGGAGCCGGAGCCCGTGTACAGCATGGAGGCCGCTGACTACCGAGAGGCCAGC
AGCCAGCAGGGCCTGGCCTATGCCACAGAGGCTGTCTATGAAAGCGCAGAGGCCCCGGGC
CACTATCCCGCAGAGGACAGCACCTATGATGAGTACGAGAACGATCTGGGGATCACAGCC
GTCGCCCTGTACGACTACCAGGCTGCGGGCGATGATGAGATCTCATTTGACCCTGATGAC
ATCATCACCAACATCGAGATGATTGACGACGGCTGGTGGCGCGGGGTGTGCAAGGGCCGG
TACGGGCTCTTCCCAGCCAACTATGTGGAGCTGCGGCAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1719
Start on reference sequence 178
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CTTN
Symbol Nomenclature : CTTN
SYNONYM : EMS1
Designation : 1110020L01Rik|amplaxin|ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)|oncogene EMS1|src substrate cortactin
Full Nomenclature : cortactin
GENEID : 2017
GI : 60656142
GenBank Accession : AY889844
HGNC : 3338
MIM : 164765
Vega : OTTHUMG00000134307
Target GenBank: BC008799

 

Reference Sequence Alignment

  

HsCD00003834        ATGTGGAAAGCTTCAGCAGGCCACGCTGTGTCCATCGCCCAGGATGACGCGGGGGCCGAT
NM_138565.2         ATGTGGAAAGCTTCAGCAGGCCACGCTGTGTCCATCGCCCAGGATGACGCGGGGGCCGAT
NM_005231.3         ATGTGGAAAGCTTCAGCAGGCCACGCTGTGTCCATCGCCCAGGATGACGCGGGGGCCGAT
NM_001184740.1      ATGTGGAAAGCTTCAGCAGGCCACGCTGTGTCCATCGCCCAGGATGACGCGGGGGCCGAT
                    ************************************************************

HsCD00003834        GACTGGGAGACCGACCCTGATTTTGTGAATGATGTGAGTGAGAAGGAGCAAAGATGGGGT
NM_138565.2         GACTGGGAGACCGACCCTGATTTTGTGAATGATGTGAGTGAGAAGGAGCAAAGATGGGGT
NM_005231.3         GACTGGGAGACCGACCCTGATTTTGTGAATGATGTGAGTGAGAAGGAGCAAAGATGGGGT
NM_001184740.1      GACTGGGAGACCGACCCTGATTTTGTGAATGATGTGAGTGAGAAGGAGCAAAGATGGGGT
                    ************************************************************

HsCD00003834        GCCAAGACGGTGCAGGGCTCCGGGCACCAGGAGCATATCAACATACACAAGCTGAGGGAG
NM_138565.2         GCCAAGACGGTGCAGGGCTCCGGGCACCAGGAGCATATCAACATACACAAGCTGAGGGAG
NM_005231.3         GCCAAGACGGTGCAGGGCTCCGGGCACCAGGAGCATATCAACATACACAAGCTGAGGGAG
NM_001184740.1      GCCAAGACGGTGCAGGGCTCCGGGCACCAGGAGCATATCAACATACACAAGCTGAGGGAG
                    ************************************************************

HsCD00003834        AATGTCTTTCAAGAGCATCAGACCCTTAAGGAGAAGGAACTTGAAACAGGACCAAAAGCT
NM_138565.2         AATGTCTTTCAAGAGCATCAGACCCTTAAGGAGAAGGAACTTGAAACAGGACCAAAAGCT
NM_005231.3         AATGTCTTTCAAGAGCATCAGACCCTTAAGGAGAAGGAACTTGAAACAGGACCAAAAGCT
NM_001184740.1      AATGTCTTTCAAGAGCATCAGACCCTTAAGGAGAAGGAACTTGAAACAGGACCAAAAGCT
                    ************************************************************

HsCD00003834        TCCCATGGCTATGGAGGGAAATTTGGTGTGGAACAAGACCGAATGGATAAGTCAGCTGTC
NM_138565.2         TCCCATGGCTATGGAGGGAAATTTGGTGTGGAACAAGACCGAATGGATAAGTCAGCTGTC
NM_005231.3         TCCCATGGCTATGGAGGGAAATTTGGTGTGGAACAAGACCGAATGGATAAGTCAGCTGTC
NM_001184740.1      TCCCATGGCTATGGAGGGAAATTTGGTGTGGAACAAGACCGAATGGATAAGTCAGCTGTC
                    ************************************************************

HsCD00003834        GGCCACGAATATCAGTCGAAACTTTCCAAGCACTGCTCGCAGGTGGACTCGGTCCGTGGC
NM_138565.2         GGCCACGAATATCAGTCGAAACTTTCCAAGCACTGCTCGCAGGTGGACTCGGTCCGTGGC
NM_005231.3         GGCCACGAATATCAGTCGAAACTTTCCAAGCACTGCTCGCAGGTGGACTCGGTCCGTGGC
NM_001184740.1      GGCCACGAATATCAGTCGAAACTTTCCAAGCACTGCTCGCAGGTGGACTCGGTCCGTGGC
                    ************************************************************

HsCD00003834        TTCGGAGGCAAGTTTGGTGTCCAGATGGACAGAGTTGATCAGTCTGCTGTAGGCTTTGAA
NM_138565.2         TTCGGAGGCAAGTTTGGTGTCCAGATGGACAGAGTTGATCAGTCTGCTGTAGGCTTTGAA
NM_005231.3         TTCGGAGGCAAGTTTGGTGTCCAGATGGACAGAGTTGATCAGTCTGCTGTAGGCTTTGAA
NM_001184740.1      TTCGGAGGCAAGTTTGGTGTCCAGATGGACAGAGTTGATCAGTCTGCTGTAGGCTTTGAA
                    ************************************************************

HsCD00003834        TACCAGGGGAAGACTGAGAAGCATGCCTCCCAGAAAGACTACTCCAGTGGTTTTGGCGGC
NM_138565.2         TACCAGGGGAAGACTGAGAAGCATGCCTCCCAGAAAGACTACTCCAGTGGTTTTGGCGGC
NM_005231.3         TACCAGGGGAAGACTGAGAAGCATGCCTCCCAGAAAGACTACTCCAGTGGTTTTGGCGGC
NM_001184740.1      TACCAGGGGAAGACTGAGAAGCATGCCTCCCAGAAAGACTACTCCAGTGGTTTTGGCGGC
                    ************************************************************

HsCD00003834        AAGTATGGCGTGCAGGCCGACCGAGTAGACAAGAGCGCGGTGGGCTTCGACTACCAGGGC
NM_138565.2         AAGTATGGCGTGCAGGCCGACCGAGTAGACAAGAGCGCGGTGGGCTTCGACTACCAGGGC
NM_005231.3         AAGTATGGCGTGCAGGCCGACCGAGTAGACAAGAGCGCGGTGGGCTTCGACTACCAGGGC
NM_001184740.1      AAGTATGGCGTGCAGGCCGACCGAGTAGACAAGAGCGCGGTGGGCTTCGACTACCAGGGC
                    ************************************************************

HsCD00003834        AAGACGGAGAAGCACGAGTCACAGAGAGATTACTCCAAAGGTTTCGGCGGCAAATACGGT
NM_138565.2         AAGACGGAGAAGCACGAGTCACAGAGAGATTACTCCAAAGGTTTCGGCGGCAAATACGGT
NM_005231.3         AAGACGGAGAAGCACGAGTCACAGAGAGATTACTCCAAAGGTTTCGGCGGCAAATACGGT
NM_001184740.1      AAGACGGAGAAGCACGAGTCACAGAGAGATTACTCCAAAGGTTTCGGCGGCAAATACGGT
                    ************************************************************

HsCD00003834        ATCGACAAGGACAAAGTGGATAAGAGCGCCGTTGGCTTTGAGTATCAAGGCAAAACGGAG
NM_138565.2         ATCGACAAGGACAAAGTGGATAAGAGCGCCGTTGGCTTTGAGTATCAAGGCAAAACGGAG
NM_005231.3         ATCGACAAGGACAAAGTGGATAAGAGCGCCGTTGGCTTTGAGTATCAAGGCAAAACGGAG
NM_001184740.1      ATCGACAAGGACAAAGTGGATAAGAGCGCCGTTGGCTTTGAGTATCAAGGCAAAACGGAG
                    ************************************************************

HsCD00003834        AAGCACGAGTCCCAGAAAGACTATGTGAAAGGGTTTGGAGGAAAATTTGGTGTGCAGACA
NM_138565.2         AAGCACGAGTCCCAGAAAGACTATGTGAAAGGGTTTGGAGGAAAATTTGGTGTGCAGACA
NM_005231.3         AAGCACGAGTCCCAGAAAGACTATGTGAAAGGGTTTGGAGGAAAATTTGGTGTGCAGACA
NM_001184740.1      AAGCACGAGTCCCAGAAAGACTATGTGAAAGGGTTTGGAGGAAAATTTGGTGTGCAGACA
                    ************************************************************

HsCD00003834        GACAGACAAGACAAATGTGCCCTTGGCTGGGATCACCAGGAGAAATTGCAGCTGCAT---
NM_138565.2         GACAGACAAGACAAATGTGCCCTTGGCTGGGATCACCAGGAGAAATTGCAGCTGCATGAA
NM_005231.3         GACAGACAAGACAAATGTGCCCTTGGCTGGGATCACCAGGAGAAATTGCAGCTGCATGAA
NM_001184740.1      GACAGACAAGACAAATGTGCCCTTGGCTGGGATCACCAGGAGAAATTGCAGCTGCATGAA
                    *********************************************************   

HsCD00003834        ------------------------------------------------------------
NM_138565.2         TCCCAAAAAG--------------------------------------------------
NM_005231.3         TCCCAAAAAGATTATAAGACTGGTTTTGGAGGCAAATTCGGTGTTCAGTCGGAGAGGCAG
NM_001184740.1      TCCCAAAAAG--------------------------------------------------
                                                                                

HsCD00003834        ------------------------------------------------GAATCCCAAAAA
NM_138565.2         ------------------------------------------------------------
NM_005231.3         GACTCCGCTGCTGTGGGGTTTGATTACAAGGAGAAGCTGGCCAAGCACGAGTCCCAGCAA
NM_001184740.1      ------------------------------------------------------------
                                                                                

HsCD00003834        GACTACTCCAAAGGATTCGGCGGGAAGTATGGGGTGCAGAAGGATCGGATGGATAAGAAT
NM_138565.2         -ACTACTCCAAAGGATTCGGCGGGAAGTATGGGGTGCAGAAGGATCGGATGGATAAGAAT
NM_005231.3         GACTACTCCAAAGGATTCGGCGGGAAGTATGGGGTGCAGAAGGATCGGATGGATAAGAAT
NM_001184740.1      -ACTACTCCAAAGGATTCGGCGGGAAGTATGGGGTGCAGAAGGATCGGATGGATAAGAAT
                     ***********************************************************

HsCD00003834        GCGTCAACCTTTGAGGATGTCACCCAGGTGTCCTCTGCCTACCAGAAGACAGTACCTGTC
NM_138565.2         GCGTCAACCTTTGAGGATGTCACCCAGGTGTCCTCTGCCTACCAGAAGACAGTACCTGTC
NM_005231.3         GCGTCAACCTTTGAGGATGTCACCCAGGTGTCCTCTGCCTACCAGAAGACAGTACCTGTC
NM_001184740.1      GCGTCAACCTTTGAGGATGTCACCCAGGTGTCCTCTGCCTACCAGAAGACAGTACCTGTC
                    ************************************************************

HsCD00003834        GAAGCTGTGACCAGCAAAACAAGTAACATCAGAGCTAACTTTGAAAACCTCGCTAAGGAG
NM_138565.2         GAAGCTGTGACCAGCAAAACAAGTAACATCAGAGCTAACTTTGAAAACCTCGCTAAGGAG
NM_005231.3         GAAGCTGTGACCAGCAAAACAAGTAACATCAGAGCTAACTTTGAAAACCTCGCTAAGGAG
NM_001184740.1      GAAGCTGTGACCAGCAAAACAAGTAACATCAGAGCTAACTTTGAAAACCTCGCTAAGGAG
                    ************************************************************

HsCD00003834        AAAGAGCAGGAGGACAGGCGGAAGGCGGAGGCGGAGAGAGCCCAGCGGATGGCCAAGGAG
NM_138565.2         AAAGAGCAGGAGGACAGGCGGAAGGCGGAGGCGGAGAGAGCCCAGCGGATGGCCAAGGAG
NM_005231.3         AAAGAGCAGGAGGACAGGCGGAAGGCGGAGGCGGAGAGAGCCCAGCGGATGGCCAAGGAG
NM_001184740.1      AAAGAGCAGGAGGACAGGCGGAAGGCGGAGGCGGAGAGAGCCCAGCGGATGGCCAAGGAG
                    ************************************************************

HsCD00003834        CGGCAGGAGCAGGAAGAGGCCAGGAGGAAGCTGGAGGAGCAAGCCAGAGCCAAAACGCAA
NM_138565.2         CGGCAGGAGCAGGAAGAGGCCAGGAGGAAGCTGGAGGAGCAAGCCAGAGCCAAAACGCAA
NM_005231.3         CGGCAGGAGCAGGAAGAGGCCAGGAGGAAGCTGGAGGAGCAAGCCAGAGCCAAAACGCAA
NM_001184740.1      CGGCAGGAGCAGGAAGAGGCCAGGAGGAAGCTGGAGGAGCAAGCCAGAGCCAAAACGCAA
                    ************************************************************

HsCD00003834        ACGCCCCCTGTGTCGCCCGCACCTCAGCCAACCGAGGAGAGGCTGCCCTCGAGCCCCGTC
NM_138565.2         ACGCCCCCTGTGTCGCCCGCACCTCAGCCAACCGAGGAGAGGCTGCCCTCGAGCCCCGTC
NM_005231.3         ACGCCCCCTGTGTCGCCCGCACCTCAGCCAACCGAGGAGAGGCTGCCCTCGAGCCCCGTC
NM_001184740.1      ACGCCCCCTGTGTCGCCCGCACCTCAGCCAACCGAGGAGAGGCTGCCCTCGAGCCCCGTC
                    ************************************************************

HsCD00003834        TATGAGGATGCGGCTTCCTTCAAGGCAGAGCTGAGCTACAGAGGCCCTGTGAGTGGGACG
NM_138565.2         TATGAGGATGCGGCTTCCTTCAAGGCAGAGCTGAGCTACAGAGGCCCTGTGAGTGGGACG
NM_005231.3         TATGAGGATGCGGCTTCCTTCAAGGCAGAGCTGAGCTACAGAGGCCCTGTGAGTGGGACG
NM_001184740.1      TATGAGGATGCGGCTTCCTTCAAGGCAGAGCTGAGCTACAGAGGCCCTGTGAGTGGGACG
                    ************************************************************

HsCD00003834        GAGCCGGAGCCCGTGTACAGCATGGAGGCCGCTGACTACCGAGAGGCCAGCAGCCAGCAG
NM_138565.2         GAGCCGGAGCCCGTGTACAGCATGGAGGCCGCTGACTACCGAGAGGCCAGCAGCCAGCAG
NM_005231.3         GAGCCGGAGCCCGTGTACAGCATGGAGGCCGCTGACTACCGAGAGGCCAGCAGCCAGCAG
NM_001184740.1      GAGCCGGAGCCCGTGTACAGCATGGAGGCCGCTGACTACCGAGAGGCCAGCAGCCAGCAG
                    ************************************************************

HsCD00003834        GGCCTGGCCTATGCCACAGAGGCTGTCTATGAAAGCGCAGAGGCCCCGGGCCACTATCCC
NM_138565.2         GGCCTGGCCTATGCCACAGAGGCTGTCTATGAAAGCGCAGAGGCCCCGGGCCACTATCCC
NM_005231.3         GGCCTGGCCTATGCCACAGAGGCTGTCTATGAAAGCGCAGAGGCCCCGGGCCACTATCCC
NM_001184740.1      GGCCTGGCCTATGCCACAGAGGCTGTCTATGAAAGCGCAGAGGCCCCGGGCCACTATCCC
                    ************************************************************

HsCD00003834        GCAGAGGACAGCACCTATGATGAGTACGAGAACGATCTGGGGATCACAGCCGTCGCCCTG
NM_138565.2         GCAGAGGACAGCACCTACGATGAGTACGAGAACGATCTGGGGATCACAGCCGTCGCCCTG
NM_005231.3         GCAGAGGACAGCACCTACGATGAGTACGAGAACGATCTGGGGATCACAGCCGTCGCCCTG
NM_001184740.1      GCAGAGGACAGCACCTACGATGAGTACGAGAACGATCTGGGGATCACAGCCGTCGCCCTG
                    ***************** ******************************************

HsCD00003834        TACGACTACCAGGCTGCGGGCGATGATGAGATCTCATTTGACCCTGATGACATCATCACC
NM_138565.2         TACGACTACCAGGCTGCGGGCGATGATGAGATCTCATTTGACCCTGATGACATCATCACC
NM_005231.3         TACGACTACCAGGCTGCGGGCGATGATGAGATCTCATTTGACCCTGATGACATCATCACC
NM_001184740.1      TACGACTACCAGGCTGCGGGCGATGATGAGATCTCATTTGACCCTGATGACATCATCACC
                    ************************************************************

HsCD00003834        AACATCGAGATGATTGACGACGGCTGGTGGCGCGGGGTGTGCAAGGGCCGGTACGGGCTC
NM_138565.2         AACATCGAGATGATTGACGACGGCTGGTGGCGCGGGGTGTGCAAGGGCCGGTACGGGCTC
NM_005231.3         AACATCGAGATGATTGACGACGGCTGGTGGCGCGGGGTGTGCAAGGGCCGGTACGGGCTC
NM_001184740.1      AACATCGAGATGATTGACGACGGCTGGTGGCGCGGGGTGTGCAAGGGCCGCTTCAGGGAG
                    ************************************************** *:*.** : 

HsCD00003834        TTCCCAGCCAACTATGTGGAGCTGCGGCAGTAG---------------------------
NM_138565.2         TTCCCAGCCAACTATGTGGAGCTGCGGCAGTAG---------------------------
NM_005231.3         TTCCCAGCCAACTATGTGGAGCTGCGGCAGTAG---------------------------
NM_001184740.1      CTCGCATTCTCTTGTGTTCGTGTTGCCCTCGTGCCCATCAAGTGCAGTCGGGACCTCCCA
                     ** **  *:. *.***  .  *    *:  :*                           

HsCD00003834        ------------------------------------------------------------
NM_138565.2         ------------------------------------------------------------
NM_005231.3         ------------------------------------------------------------
NM_001184740.1      GGACAAGCACGAGGCCTCAGGTCGGCCCTGTGGCGGGTAGGCAGGAAGGACTGTCCCAGA
                                                                                

HsCD00003834        ------------------------------------------------------------
NM_138565.2         ------------------------------------------------------------
NM_005231.3         ------------------------------------------------------------
NM_001184740.1      CGAGGGGCTTCCTCTAGAGTCTCACTGCTGGGGAGGAGAGGACTGGGCCTGATGGAAGTT
                                                                                

HsCD00003834        ------------------------------------------------------------
NM_138565.2         ------------------------------------------------------------
NM_005231.3         ------------------------------------------------------------
NM_001184740.1      AACCCGGAGCTAAGTCACCCAGAGCACAGGAGCTGCCATGTCAGATGGGAAATCTGCCTA
                                                                                

HsCD00003834        ------------------------------------------------------------
NM_138565.2         ------------------------------------------------------------
NM_005231.3         ------------------------------------------------------------
NM_001184740.1      TGTCATACCGTGACAGCCCGCAGGATCAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAG
                                                                                

HsCD00003834        ------------------------------------------------------------
NM_138565.2         ------------------------------------------------------------
NM_005231.3         ------------------------------------------------------------
NM_001184740.1      GCTGGACCAGTCCCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGG
                                                                                

HsCD00003834        ------------------------------------
NM_138565.2         ------------------------------------
NM_005231.3         ------------------------------------
NM_001184740.1      AAATGTCTCGGGACTTGGGTCCCGGAGTGCCCGTGA
                                                        

Pathways

NCI : E-cadherin signaling in the nascent adherens junction
NCI : FGF signaling pathway
NCI : N-cadherin signaling events
NCI : PDGFR-beta signaling pathway
NCI : Syndecan-3-mediated signaling events

Protein

SMART domain : SH3 : Src homology 3 domains
UniProt : Q14247
UniProt : Q53HG7
UniProt : Q8N707
UniProt : Q96H99
HPRD : 01268

Clone

Cloning Information : 27816
HIP Master Clone ID : 58192
Original Clone ID : FLH027816.01X

Organism


TAX_ID : 9606
Species Specific ID: 2017

Genome

Chromosome : 11
Map Location : 11q13
Ensembl : ENSG00000085733

Reagents

Labome : cortactin-antibody