DNASU Plasmid Repository • 480.965.2857 | Email

CTDSPL (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CTDSPL
Gene Name:  CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Sequence             
Original Clone ID: 8718a2BCt3p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified. Actual 5' flanking sequence provided below.
Mutation/
Discrepancy :
No / No
Publications: PMID: 18058037
Title: Structural genomics of protein phosphatases
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00383445

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 579nts         Open reading frame : 29 to 607
Reference Sequence Alignment

TTAAGAAGGAGATATACATATGTCCCTTAGGCAGGTCATTCCCATACCAAGTCCACCAGC
TAAGTACTTTCTTCCAGAGGTGACGGTGCTTGACTATGGAAAGAAATGTGTGGTCATTGA
TTTAGATGAAACATTGGTGCACAGTTCGTTTAAGCCTATTAGTAATGCTGATTTTATTGT
TCCGGTTGAAATCGATGGAACTATACATCAGGTGTATGTGCTGAAGCGGCCACATGTGGA
CGAGTTCCTCCAGAGGATGGGGCAGCTTTTTGAATGTGTGCTCTTTACTGCCAGCTTGGC
CAAGTATGCAGACCCTGTGGCTGACCTCCTAGACCGCTGGGGTGTGTTCCGGGCCCGGCT
CTTCAGAGAATCATGTGTTTTTCATCGTGGGAACTACGTGAAGGACCTGAGTCGCCTTGG
GCGGGAGCTGAGCAAAGTGATCATTGTTGACAATTCCCCTGCCTCATACATCTTCCATCC
TGAGAATGCAGTGCCTGTGCAGTCCTGGTTCGATGACATGACGGACACGGAGCTGCTGGA
CCTCATCCCCTTCTTTGAGGGCCTGAGCCGGGAGGACGACGAAGGGCATCATCACCATCA
CCACTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8718a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CTDSPL
Symbol Nomenclature : CTDSPL
SYNONYM : C3orf8; HYA22; PSR1; RBSP3; SCP3
Designation : CTD small phosphatase-like protein|CTDSP-like|NIF-like protein|NLI-interacting factor 1|RB protein serine phosphatase from chromosome 3|carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 3|nuclear LIM interactor-interacting factor 1|small C-terminal domain phosphatase 3|small CTD phosphatase 3
Full Nomenclature : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
GENEID : 10217
GI : 56549683
GenBank Accession : NM_001008392
HGNC : 16890
MIM : 608592
Vega : OTTHUMG00000155942
Target GenBank: NM_001008392

 

Reference Sequence Alignment

  

HsCD00383445        --------------------------------------TTAAGAAGGAGATATACATATG
NM_005808.2         ATGGACGGCCCGGCCATCATCACCCAGGTGACCAACCCCAAGGAGGACGAGGGCCGGTTG
NM_001008392.1      ATGGACGGCCCGGCCATCATCACCCAGGTGACCAACCCCAAGGAGGACGAGGGCCGGTTG
                                                           :*.**.*..** . .*. :**

HsCD00383445        TCCCTTAGGCAGGTCATTCCCATACCAAG-------------------------------
NM_005808.2         CCGGGCGCGGGCGAGAAAGCCTCCCAGTGCAACGTCAGCTTAAAGAAGCAGAGGAGCCGC
NM_001008392.1      CCGGGCGCGGGCGAGAAAGCCTCCCAGTGCAACGTCAGCTTAAAGAAGCAGAGGAGCCGC
                     *    . * . *: *:: **: .*..:*                               

HsCD00383445        ------------------------------------------------------------
NM_005808.2         AGCATCCTTAGCTCCTTCTTCTGCTGCTTCCGTGATTACAATGTGGAGGCCCCTCCACCC
NM_001008392.1      AGCATCCTTAGCTCCTTCTTCTGCTGCTTCCGTGATTACAATGTGGAGGCCCCTCCACCC
                                                                                

HsCD00383445        ------------------------------------------------------------
NM_005808.2         AGCAGCCCCAGTGTGCTTCCGCCACTGGTGGAGGAGAATGGTGGGCTTCAGAAG------
NM_001008392.1      AGCAGCCCCAGTGTGCTTCCGCCACTGGTGGAGGAGAATGGTGGGCTTCAGAAGGGTGAC
                                                                                

HsCD00383445        --------------------------TCCACCAGCTAAGTACTTTCTTCCAGAGGTGACG
NM_005808.2         ---------------------------CCACCAGCTAAGTACCTTCTTCCAGAGGTGACG
NM_001008392.1      CAGAGGCAGGTCATTCCCATACCAAGTCCACCAGCTAAGTACCTTCTTCCAGAGGTGACG
                                               *************** *****************

HsCD00383445        GTGCTTGACTATGGAAAGAAATGTGTGGTCATTGATTTAGATGAAACATTGGTGCACAGT
NM_005808.2         GTGCTTGACTATGGAAAGAAATGTGTGGTCATTGATTTAGATGAAACATTGGTGCACAGT
NM_001008392.1      GTGCTTGACTATGGAAAGAAATGTGTGGTCATTGATTTAGATGAAACATTGGTGCACAGT
                    ************************************************************

HsCD00383445        TCGTTTAAGCCTATTAGTAATGCTGATTTTATTGTTCCGGTTGAAATCGATGGAACTATA
NM_005808.2         TCGTTTAAGCCTATTAGTAATGCTGATTTTATTGTTCCGGTTGAAATCGATGGAACTATA
NM_001008392.1      TCGTTTAAGCCTATTAGTAATGCTGATTTTATTGTTCCGGTTGAAATCGATGGAACTATA
                    ************************************************************

HsCD00383445        CATCAGGTGTATGTGCTGAAGCGGCCACATGTGGACGAGTTCCTCCAGAGGATGGGGCAG
NM_005808.2         CATCAGGTGTATGTGCTGAAGCGGCCACATGTGGACGAGTTCCTCCAGAGGATGGGGCAG
NM_001008392.1      CATCAGGTGTATGTGCTGAAGCGGCCACATGTGGACGAGTTCCTCCAGAGGATGGGGCAG
                    ************************************************************

HsCD00383445        CTTTTTGAATGTGTGCTCTTTACTGCCAGCTTGGCCAAGTATGCAGACCCTGTGGCTGAC
NM_005808.2         CTTTTTGAATGTGTGCTCTTTACTGCCAGCTTGGCCAAGTATGCAGACCCTGTGGCTGAC
NM_001008392.1      CTTTTTGAATGTGTGCTCTTTACTGCCAGCTTGGCCAAGTATGCAGACCCTGTGGCTGAC
                    ************************************************************

HsCD00383445        CTCCTAGACCGCTGGGGTGTGTTCCGGGCCCGGCTCTTCAGAGAATCATGTGTTTTTCAT
NM_005808.2         CTCCTAGACCGCTGGGGTGTGTTCCGGGCCCGGCTCTTCAGAGAATCATGTGTTTTTCAT
NM_001008392.1      CTCCTAGACCGCTGGGGTGTGTTCCGGGCCCGGCTCTTCAGAGAATCATGTGTTTTTCAT
                    ************************************************************

HsCD00383445        CGTGGGAACTACGTGAAGGACCTGAGTCGCCTTGGGCGGGAGCTGAGCAAAGTGATCATT
NM_005808.2         CGTGGGAACTACGTGAAGGACCTGAGTCGCCTTGGGCGGGAGCTGAGCAAAGTGATCATT
NM_001008392.1      CGTGGGAACTACGTGAAGGACCTGAGTCGCCTTGGGCGGGAGCTGAGCAAAGTGATCATT
                    ************************************************************

HsCD00383445        GTTGACAATTCCCCTGCCTCATACATCTTCCATCCTGAGAATGCAGTGCCTGTGCAGTCC
NM_005808.2         GTTGACAATTCCCCTGCCTCATACATCTTCCATCCTGAGAATGCAGTGCCTGTGCAGTCC
NM_001008392.1      GTTGACAATTCCCCTGCCTCATACATCTTCCATCCTGAGAATGCAGTGCCTGTGCAGTCC
                    ************************************************************

HsCD00383445        TGGTTCGATGACATGACGGACACGGAGCTGCTGGACCTCATCCCCTTCTTTGAGGGCCTG
NM_005808.2         TGGTTCGATGACATGACGGACACGGAGCTGCTGGACCTCATCCCCTTCTTTGAGGGCCTG
NM_001008392.1      TGGTTCGATGACATGACGGACACGGAGCTGCTGGACCTCATCCCCTTCTTTGAGGGCCTG
                    ************************************************************

HsCD00383445        AGCCGGGAGGACGACGAAGGGCATCATCACCATCACCACTGATCCGAATTCGAGCTCCGT
NM_005808.2         AGCCGGGAGGACGACGTGTACAGCATGCTGCACAGACTCTGCAATAGGTAG---------
NM_001008392.1      AGCCGGGAGGACGACGTGTACAGCATGCTGCACAGACTCTGCAATAGGTAG---------
                    ****************:. . .. .: *: ** ...*:***.:. ...*:          

HsCD00383445        CGACAAGCTTGCGGC
NM_005808.2         ---------------
NM_001008392.1      ---------------
                                   

Pathways

NCI : BMP receptor signaling
NCI : Regulation of cytoplasmic and nuclear SMAD2/3 signaling

Protein

PDB - Structural Annotation : 2HHL
SMART domain : CPDc : catalytic domain of ctd-like phosphatases
Structural Annotation Wiki : TOPSAN
UniProt : O15194
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 494225
HIP Master Clone ID : 407905
Original Clone ID : 8718a2BCt3p1

Experimental

Structural Biology Knowledgebase : SBKB (2HHL)
TargetTrack - Experimental data : NYSGXRC-8718a

Organism


TAX_ID : 9606
Species Specific ID: 10217

Genome

Chromosome : 3
Map Location : 3p21.3
Ensembl : ENSG00000144677

Reagents

Labome : CTDSPL-antibody