DNASU Plasmid Repository • 480.965.5697 | Email

HCK (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HCK
Gene Name:  hemopoietic cell kinase
Sequence             
Original Clone ID: FLH205282.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038416

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1518nts         Open reading frame : 1 to 1518
Reference Sequence Alignment

ATGGGGTCGATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACTGAA
ACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAGCCG
GGGCCTAATAGCCACAACAGCAACACACCGGGAATCAGGGAGGCAGGCTCTGAGGACATC
ATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTCCAGAAG
GGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCCCTGGCC
ACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAGACA
GAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCTCCC
GGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTACTCT
TTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATCCGG
ACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAGGAG
CTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTGCCCTGC
ATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGGGAATCC
CTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTAC
AACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAGGCC
TTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTTCAT
GCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCTTG
CTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGACTTC
TCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGAGAC
CTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGACTTTGGC
CTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCCATC
AAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTCTGG
TCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGGATG
TCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAGAAC
TGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAGCGG
CCGACCTTCGAATACATCCAGAGTGTGCTGGATGATTTCTACACGGCCACAGAGAGCCAG
TACCAACAGCAGCCATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1686
Start on reference sequence 169
Mutations:
None
Discrepancy:
a150g; c1476t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HCK
Symbol Nomenclature : HCK
SYNONYM : JTK9; p59Hck; p61Hck
Designation : hematopoietic cell kinase|p59-HCK/p60-HCK|tyrosine-protein kinase HCK
Full Nomenclature : hemopoietic cell kinase
GENEID : 3055
Locus Tag : RP5-836N17.3
HGNC : 4840
MIM : 142370
Vega : OTTHUMG00000032204
Target GenBank: M16591

 

Reference Sequence Alignment

  

HsCD00038416        ------------------------------------------------------------
NM_001172130.1      CTGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCC
NM_001172129.1      ------------------------------------------------------------
NM_001172132.1      ------------------------------------------------------------
NM_001172133.1      ------------------------------------------------------------
NM_001172131.1      ------------------------------------------------------------
NM_002110.3         CTGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCC
                                                                                

HsCD00038416        ---ATGGGGTCGATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172130.1      AGGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172129.1      ---ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172132.1      ATGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172133.1      ---ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_001172131.1      ---ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
NM_002110.3         AGGATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACT
                       *******  ************************************************

HsCD00038416        GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172130.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172129.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172132.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172133.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_001172131.1      GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
NM_002110.3         GAAACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAG
                    ************************************************************

HsCD00038416        CCGGGGCCTAATAGCCACAACAGCAACACACCGGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172130.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAG---GGCTCTGAG
NM_001172129.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172132.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172133.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
NM_001172131.1      CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAG------GGCTCTGAG
NM_002110.3         CCGGGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGG---GAGGCAGGCTCTGAG
                    ********************************.*********         *********

HsCD00038416        GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172130.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172129.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172132.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172133.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_001172131.1      GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
NM_002110.3         GACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTC
                    ************************************************************

HsCD00038416        CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172130.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172129.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172132.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172133.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_001172131.1      CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
NM_002110.3         CAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCC
                    ************************************************************

HsCD00038416        CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172130.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172129.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172132.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172133.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_001172131.1      CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
NM_002110.3         CTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTG
                    ************************************************************

HsCD00038416        GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172130.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172129.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172132.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172133.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_001172131.1      GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
NM_002110.3         GAGACAGAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTG
                    ************************************************************

HsCD00038416        GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172130.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172129.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172132.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172133.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_001172131.1      GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
NM_002110.3         GCTCCCGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGC
                    ************************************************************

HsCD00038416        TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172130.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172129.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172132.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172133.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_001172131.1      TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
NM_002110.3         TACTCTTTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAG
                    ************************************************************

HsCD00038416        ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172130.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172129.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172132.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172133.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_001172131.1      ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
NM_002110.3         ATCCGGACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTG
                    ************************************************************

HsCD00038416        CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172130.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172129.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172132.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172133.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_001172131.1      CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
NM_002110.3         CAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTG
                    ************************************************************

HsCD00038416        CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172130.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172129.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172132.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172133.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_001172131.1      CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
NM_002110.3         CCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGG
                    ************************************************************

HsCD00038416        GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172130.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172129.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172132.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172133.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_001172131.1      GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
NM_002110.3         GAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCC
                    ************************************************************

HsCD00038416        ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172130.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172129.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172132.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172133.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_001172131.1      ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
NM_002110.3         ACCTACAACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTG
                    ************************************************************

HsCD00038416        GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172130.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172129.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172132.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172133.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_001172131.1      GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
NM_002110.3         GAGGCCTTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAA
                    ************************************************************

HsCD00038416        CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172130.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172129.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172132.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172133.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_001172131.1      CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
NM_002110.3         CTTCATGCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGA
                    ************************************************************

HsCD00038416        AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172130.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172129.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172132.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172133.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_001172131.1      AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
NM_002110.3         AGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATT
                    ************************************************************

HsCD00038416        GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172130.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172129.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172132.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172133.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_001172131.1      GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
NM_002110.3         GACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCAC
                    ************************************************************

HsCD00038416        CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172130.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172129.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172132.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172133.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_001172131.1      CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
NM_002110.3         CGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGAC
                    ************************************************************

HsCD00038416        TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172130.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172129.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172132.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172133.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_001172131.1      TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
NM_002110.3         TTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTC
                    ************************************************************

HsCD00038416        CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172130.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172129.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172132.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172133.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_001172131.1      CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
NM_002110.3         CCCATCAAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGAC
                    ************************************************************

HsCD00038416        GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172130.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172129.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172132.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172133.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_001172131.1      GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
NM_002110.3         GTCTGGTCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCA
                    ************************************************************

HsCD00038416        GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172130.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172129.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172132.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172133.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_001172131.1      GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
NM_002110.3         GGGATGTCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCA
                    ************************************************************

HsCD00038416        GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172130.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172129.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172132.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172133.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_001172131.1      GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
NM_002110.3         GAGAACTGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAG
                    ************************************************************

HsCD00038416        GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGATTTCTACACGGCCACAGAG
NM_001172130.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172129.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172132.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172133.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_001172131.1      GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
NM_002110.3         GAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAG
                    ***************************************** ******************

HsCD00038416        AGCCAGTACCAACAGCAGCCATTG
NM_001172130.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172129.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172132.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172133.1      AGCCAGTACCAACAGCAGCCATGA
NM_001172131.1      AGCCAGTACCAACAGCAGCCATGA
NM_002110.3         AGCCAGTACCAACAGCAGCCATGA
                    ********************** .

Pathways

NCI : Alpha-synuclein signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EPHA forward signaling
NCI : Ephrin B reverse signaling
NCI : Glypican 1 network
NCI : IL6-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Parkinson disease
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : FCGR activation
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Nef and signal transduction
Reactome : Regulation of signaling by CBL
Reactome : Signaling by Interleukins
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
WikiPathway : Focal Adhesion
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-6 signaling pathway

Clone

Cloning Information : 205282
HIP Master Clone ID : 33081
Original Clone ID : FLH205282.01L

Organism


TAX_ID : 9606
Species Specific ID: 3055

Genome

Chromosome : 20
Map Location : 20q11-q12
Ensembl : ENSG00000101336

Reagents

Labome : HCK-antibody