DNASU Plasmid Repository • 480.965.5697 | Email

MAPK9 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK9
Gene Name:  mitogen-activated protein kinase 9
Sequence             
Original Clone ID: FLH205283.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038417

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1149nts         Open reading frame : 1 to 1149
Reference Sequence Alignment

ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT
TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC
AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA
TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC
ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA
CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA
TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC
ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG
GGCTACAAAGAGAACGTGGACATCTGGTCTGTCGGGTGCATCATGGCAGAAATGGTCCTC
CATAAAGTCCTGTTCCCGGGAAGAGACTATATTGATCAGTGGAATAAAGTTATTGAGCAG
CTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTC
GAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTC
CCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAA
ATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATAC
ATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCC
CAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTC
ATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGCACAGATG
CAGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1198
Start on reference sequence 50
Mutations:
None
Discrepancy:
t618g; t621c; a630t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK9
Symbol Nomenclature : MAPK9
SYNONYM : JNK-55; JNK2; JNK2A; JNK2ALPHA; JNK2B; JNK2BETA; PRKM9; SAPK; SAPK1a; p54a; p54aSAPK
Designation : Jun kinase|MAP kinase 9|MAPK 9|c-Jun N-terminal kinase 2|c-Jun kinase 2|stress-activated protein kinase 1a|stress-activated protein kinase JNK2
Full Nomenclature : mitogen-activated protein kinase 9
GENEID : 5601
HGNC : 6886
MIM : 602896
Vega : OTTHUMG00000130934
Target GenBank: NM_139069

 

Reference Sequence Alignment

  

HsCD00038417      ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
NM_002752.4       ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
NM_139070.2       ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
NM_139068.2       ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
NM_139069.2       ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
                  ************************************************************

HsCD00038417      ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
NM_002752.4       ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
NM_139070.2       ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
NM_139068.2       ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
NM_139069.2       ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
                  ************************************************************

HsCD00038417      TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT
NM_002752.4       TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT
NM_139070.2       TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT
NM_139068.2       TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT
NM_139069.2       TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT
                  ************************************************************

HsCD00038417      TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC
NM_002752.4       TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC
NM_139070.2       TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC
NM_139068.2       TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC
NM_139069.2       TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC
                  ************************************************************

HsCD00038417      AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA
NM_002752.4       AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA
NM_139070.2       AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA
NM_139068.2       AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA
NM_139069.2       AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA
                  ************************************************************

HsCD00038417      TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC
NM_002752.4       TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC
NM_139070.2       TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC
NM_139068.2       TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC
NM_139069.2       TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC
                  ************************************************************

HsCD00038417      ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA
NM_002752.4       ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA
NM_139070.2       ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA
NM_139068.2       ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA
NM_139069.2       ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA
                  ************************************************************

HsCD00038417      CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA
NM_002752.4       CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA
NM_139070.2       CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA
NM_139068.2       CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA
NM_139069.2       CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA
                  ************************************************************

HsCD00038417      TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC
NM_002752.4       TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC
NM_139070.2       TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC
NM_139068.2       TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC
NM_139069.2       TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC
                  ************************************************************

HsCD00038417      ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG
NM_002752.4       ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG
NM_139070.2       ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG
NM_139068.2       ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG
NM_139069.2       ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG
                  ************************************************************

HsCD00038417      GGCTACAAAGAGAACGTGGACATCTGGTCTGTCGGGTGCATCATGGCAGAAATGGTCCTC
NM_002752.4       GGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAA
NM_139070.2       GGCTACAAAGAGAACGTGGACATCTGGTCTGTCGGGTGCATCATGGCAGAAATGGTCCTC
NM_139068.2       GGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAA
NM_139069.2       GGCTACAAAGAGAACGTGGACATCTGGTCTGTCGGGTGCATCATGGCAGAAATGGTCCTC
                  ***************** ** ********:** ** ********** ***..**** .:.

HsCD00038417      CATAAAGTCCTGTTCCCGGGAAGAGACTATATTGATCAGTGGAATAAAGTTATTGAGCAG
NM_002752.4       GGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAG
NM_139070.2       CATAAAGTCCTGTTCCCGGGAAGAGACTATATTGATCAGTGGAATAAAGTTATTGAGCAG
NM_139068.2       GGTTGTGTGATATTCCAAGGCACTGACCATATTGATCAGTGGAATAAAGTTATTGAGCAG
NM_139069.2       CATAAAGTCCTGTTCCCGGGAAGAGACTATATTGATCAGTGGAATAAAGTTATTGAGCAG
                   .*:.:** .*.****..**.* :*** ********************************

HsCD00038417      CTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTC
NM_002752.4       CTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTC
NM_139070.2       CTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTC
NM_139068.2       CTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTC
NM_139069.2       CTGGGAACACCATCAGCAGAGTTCATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTC
                  ************************************************************

HsCD00038417      GAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTC
NM_002752.4       GAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTC
NM_139070.2       GAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTC
NM_139068.2       GAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTC
NM_139069.2       GAAAACAGACCAAAGTATCCTGGAATCAAATTTGAAGAACTCTTTCCAGATTGGATATTC
                  ************************************************************

HsCD00038417      CCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAA
NM_002752.4       CCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAA
NM_139070.2       CCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAA
NM_139068.2       CCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAA
NM_139069.2       CCATCAGAATCTGAGCGAGACAAAATAAAAACAAGTCAAGCCAGAGATCTGTTATCAAAA
                  ************************************************************

HsCD00038417      ATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATAC
NM_002752.4       ATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATAC
NM_139070.2       ATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATAC
NM_139068.2       ATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATAC
NM_139069.2       ATGTTAGTGATTGATCCTGACAAGCGGATCTCTGTAGACGAAGCTCTGCGTCACCCATAC
                  ************************************************************

HsCD00038417      ATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCC
NM_002752.4       ATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCC
NM_139070.2       ATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCC
NM_139068.2       ATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCC
NM_139069.2       ATCACTGTTTGGTATGACCCCGCCGAAGCAGAAGCCCCACCACCTCAAATTTATGATGCC
                  ************************************************************

HsCD00038417      CAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTC
NM_002752.4       CAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTC
NM_139070.2       CAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTC
NM_139068.2       CAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTC
NM_139069.2       CAGTTGGAAGAAAGAGAACATGCAATTGAAGAATGGAAAGAGCTAATTTACAAAGAAGTC
                  ************************************************************

HsCD00038417      ATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGCACAGATG
NM_002752.4       ATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCA
NM_139070.2       ATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGATGCAGCA
NM_139068.2       ATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGCACAGATG
NM_139069.2       ATGGATTGGGAAGAAAGAAGCAAGAATGGTGTTGTAAAAGATCAGCCTTCAGCACAGATG
                  ****************************************************.: ... .

HsCD00038417      CAGCAGTTG---------------------------------------------------
NM_002752.4       GTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCC
NM_139070.2       GTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACATTTCATCCATGTCC
NM_139068.2       CAGCAGTAA---------------------------------------------------
NM_139069.2       CAGCAGTAA---------------------------------------------------
                   :... :                                                     

HsCD00038417      ------------------------------------------------------------
NM_002752.4       ACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTT
NM_139070.2       ACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTCGACGGGACCCCTT
NM_139068.2       ------------------------------------------------------------
NM_139069.2       ------------------------------------------------------------
                                                                              

HsCD00038417      ---------------
NM_002752.4       GAAGGCTGTCGATGA
NM_139070.2       GAAGGCTGTCGATGA
NM_139068.2       ---------------
NM_139069.2       ---------------
                                 

Pathways

NCI : ATF-2 transcription factor network
NCI : CD40/CD40L signaling
NCI : CDC42 signaling events
NCI : Downstream signaling in naïve CD8+ T cells
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FoxO family signaling
NCI : Glucocorticoid receptor regulatory network
NCI : Glypican 3 network
NCI : IL12 signaling mediated by STAT4
NCI : IL2-mediated signaling events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Noncanonical Wnt signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : RAC1 signaling pathway
NCI : Rapid glucocorticoid signaling
NCI : Regulation of retinoblastoma protein
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by focal adhesion kinase
NCI : p53 pathway
NCI : p75(NTR)-mediated signaling
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : FAS signaling pathway
Panther : Huntington disease
Panther : Integrin signalling pathway
Panther : Interferon-gamma signaling pathway
Panther : Oxidative stress response
Panther : Parkinson disease
Panther : Ras Pathway
Panther : T cell activation
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of the AP-1 family of transcription factors
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Estrogen signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-1 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MAPK signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : TyrKc : Tyrosine kinase, catalytic domain
SMART domain : S_TKc : Serine/Threonine protein kinases, catalytic domain
UniProt : B5M0B4
UniProt : P45984
HPRD : 04206

Clone

Cloning Information : 205283
HIP Master Clone ID : 33216
Original Clone ID : FLH205283.01L

Organism


TAX_ID : 9606
Species Specific ID: 5601

Genome

Chromosome : 5
Map Location : 5q35
Ensembl : ENSG00000050748

Reagents

Labome : JNK2-antibody