DNASU Plasmid Repository • 480.965.5697 | Email

UBE2H (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBE2H
Gene Name:  ubiquitin-conjugating enzyme E2H
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH025301.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003850

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 552nts         Open reading frame : 1 to 552
Reference Sequence Alignment

ATGTCATCTCCCAGTCCGGGCAAGAGGCGGATGGACACGGACGTGGTCAAGCTCATCGAG
AGTAAACATGAGGTTACGATCCTGGGAGGACTTAATGAATTTGTAGTGAAGTTTTATGGA
CCACAAGGAACACCATATGAAGGCGGAGTATGGAAAGTTAGAGTGGACCTACCTGATAAA
TACCCTTTCAAATCTCCATCTATAGGATTCATGAATAAAATTTTCCATCCCAACATTGAT
GAAGCGTCAGGAACTGTGTGTCTAGATGTAATTAATCAAACTTGGACAGCTCTCTATGAT
CTTACCAATATATTTGAGTCCTTCCTGCCTCAGTTATTGGCCTATCCTAACCCCATAGAT
CCTCTCAATGGTGACGCTGCAGCCATGTACCTCCACCGACCAGAAGAATACAAGCAGAAA
ATTAAAGAGTACATCCAGAAATACGCCACGGAGGAGGCGCTGAAAGAACAGGAAGAGGGT
ACCGGGGACAGCTCATCGGAGAGCTCTATGTCTGACTTTTCCGAAGATGAGGCCCAGGAT
ATGGAGTTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 878
Start on reference sequence 327
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBE2H
Symbol Nomenclature : UBE2H
SYNONYM : E2-20K; GID3; UBC8; UBCH; UBCH2
Designation : GID complex subunit 3, UBC8 homolog|ubiquitin carrier protein H|ubiquitin-conjugating enzyme E2 H|ubiquitin-conjugating enzyme E2-20K|ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)|ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8)|ubiquitin-protein ligase H
Full Nomenclature : ubiquitin-conjugating enzyme E2H
GENEID : 7328
GI : 60653110
GenBank Accession : AY892333
HGNC : 12484
MIM : 601082
Vega : OTTHUMG00000157650
Target GenBank: BC006277

 

Reference Sequence Alignment

  

HsCD00003850      ATGTCATCTCCCAGTCCGGGCAAGAGGCGGATGGACACGGACGTGGTCAAGCTCATCGAG
NM_003344.3       ATGTCATCTCCCAGTCCGGGCAAGAGGCGGATGGACACGGACGTGGTCAAGCTCATCGAG
                  ************************************************************

HsCD00003850      AGTAAACATGAGGTTACGATCCTGGGAGGACTTAATGAATTTGTAGTGAAGTTTTATGGA
NM_003344.3       AGTAAACATGAGGTTACGATCCTGGGAGGACTTAATGAATTTGTAGTGAAGTTTTATGGA
                  ************************************************************

HsCD00003850      CCACAAGGAACACCATATGAAGGCGGAGTATGGAAAGTTAGAGTGGACCTACCTGATAAA
NM_003344.3       CCACAAGGAACACCATATGAAGGCGGAGTATGGAAAGTTAGAGTGGACCTACCTGATAAA
                  ************************************************************

HsCD00003850      TACCCTTTCAAATCTCCATCTATAGGATTCATGAATAAAATTTTCCATCCCAACATTGAT
NM_003344.3       TACCCTTTCAAATCTCCATCTATAGGATTCATGAATAAAATTTTCCATCCCAACATTGAT
                  ************************************************************

HsCD00003850      GAAGCGTCAGGAACTGTGTGTCTAGATGTAATTAATCAAACTTGGACAGCTCTCTATGAT
NM_003344.3       GAAGCGTCAGGAACTGTGTGTCTAGATGTAATTAATCAAACTTGGACAGCTCTCTATGAT
                  ************************************************************

HsCD00003850      CTTACCAATATATTTGAGTCCTTCCTGCCTCAGTTATTGGCCTATCCTAACCCCATAGAT
NM_003344.3       CTTACCAATATATTTGAGTCCTTCCTGCCTCAGTTATTGGCCTATCCTAACCCCATAGAT
                  ************************************************************

HsCD00003850      CCTCTCAATGGTGACGCTGCAGCCATGTACCTCCACCGACCAGAAGAATACAAGCAGAAA
NM_003344.3       CCTCTCAATGGTGACGCTGCAGCCATGTACCTCCACCGACCAGAAGAATACAAGCAGAAA
                  ************************************************************

HsCD00003850      ATTAAAGAGTACATCCAGAAATACGCCACGGAGGAGGCGCTGAAAGAACAGGAAGAGGGT
NM_003344.3       ATTAAAGAGTACATCCAGAAATACGCCACGGAGGAGGCGCTGAAAGAACAGGAAGAGGGT
                  ************************************************************

HsCD00003850      ACCGGGGACAGCTCATCGGAGAGCTCTATGTCTGACTTTTCCGAAGATGAGGCCCAGGAT
NM_003344.3       ACCGGGGACAGCTCATCGGAGAGCTCTATGTCTGACTTTTCCGAAGATGAGGCCCAGGAT
                  ************************************************************

HsCD00003850      ATGGAGTTGTTG
NM_003344.3       ATGGAGTTGTAG
                  **********:*

Pathways

Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Immune System

Protein

SMART domain : UBCc : Ubiquitin-conjugating enzyme E2, catalytic domain homologues
UniProt : A4D1L5
UniProt : P62256
UniProt : Q7Z6F4
UniProt : A4D1L6
HPRD : 03052

Clone

Cloning Information : 25301
HIP Master Clone ID : 55677
Original Clone ID : FLH025301.01L

Organism


TAX_ID : 9606
Species Specific ID: 7328

Genome

Chromosome : 7
Map Location : 7q32
Ensembl : ENSG00000186591

Reagents

Labome : UBE2H-antibody