DNASU Plasmid Repository • 480.965.5697 | Email

FYN (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FYN
Gene Name:  FYN oncogene related to SRC, FGR, YES
Sequence             
Original Clone ID: FLH205516.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038596

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1614nts         Open reading frame : 1 to 1614
Reference Sequence Alignment

ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAGAGCTGCAGGTCTCTGCTGC
CGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACC
AAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGTTGATCAAGAGACTGGGAAATGGG
CAGTTTGGGGAAGTATGGATGGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
GAAGACTACTTTACCGCGACAGAGCCCCAGTACAAACCTGGTGAAAACCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2193
Start on reference sequence 580
Mutations:
None
Discrepancy:
c1594a,Q532K
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FYN
Symbol Nomenclature : FYN
SYNONYM : SLK; SYN; p59-FYN
Designation : OKT3-induced calcium influx regulator|c-syn protooncogene|proto-oncogene Syn|proto-oncogene c-Fyn|src-like kinase|src/yes-related novel|tyrosine kinase p59fyn(T)|tyrosine-protein kinase Fyn
Full Nomenclature : FYN oncogene related to SRC, FGR, YES
GENEID : 2534
Locus Tag : RP1-66H14.1
HGNC : 4037
MIM : 137025
Vega : OTTHUMG00000016305
Target GenBank: NM_002037

 

Reference Sequence Alignment

  

HsCD00038596        ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
NM_153047.3         ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
XM_005266889.1      ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
XM_005266890.1      ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
XM_005266888.1      ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
XM_005266887.1      ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
NM_002037.5         ATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGGAGAGGGACGGC
                    ************************************************************

HsCD00038596        AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
NM_153047.3         AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
XM_005266889.1      AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
XM_005266890.1      AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
XM_005266888.1      AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
XM_005266887.1      AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
NM_002037.5         AGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCC
                    ************************************************************

HsCD00038596        AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
NM_153047.3         AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
XM_005266889.1      AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
XM_005266890.1      AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
XM_005266888.1      AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
XM_005266887.1      AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
NM_002037.5         AGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGA
                    ************************************************************

HsCD00038596        CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
NM_153047.3         CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
XM_005266889.1      CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
XM_005266890.1      CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
XM_005266888.1      CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
XM_005266887.1      CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
NM_002037.5         CTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGA
                    ************************************************************

HsCD00038596        GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
NM_153047.3         GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
XM_005266889.1      GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
XM_005266890.1      GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
XM_005266888.1      GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
XM_005266887.1      GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
NM_002037.5         GGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGAC
                    ************************************************************

HsCD00038596        CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
NM_153047.3         CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
XM_005266889.1      CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
XM_005266890.1      CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
XM_005266888.1      CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
XM_005266887.1      CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
NM_002037.5         CTGAGTTTTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGGAAGGAGATTGGTGG
                    ************************************************************

HsCD00038596        GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
NM_153047.3         GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
XM_005266889.1      GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
XM_005266890.1      GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
XM_005266888.1      GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
XM_005266887.1      GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
NM_002037.5         GAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAGCAATTATGTGGCTCCA
                    ************************************************************

HsCD00038596        GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
NM_153047.3         GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
XM_005266889.1      GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
XM_005266890.1      GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
XM_005266888.1      GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
XM_005266887.1      GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
NM_002037.5         GTTGACTCTATCCAGGCAGAAGAGTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAG
                    ************************************************************

HsCD00038596        CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
NM_153047.3         CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
XM_005266889.1      CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
XM_005266890.1      CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
XM_005266888.1      CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
XM_005266887.1      CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
NM_002037.5         CGACAGCTATTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACC
                    ************************************************************

HsCD00038596        ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
NM_153047.3         ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
XM_005266889.1      ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
XM_005266890.1      ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
XM_005266888.1      ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
XM_005266887.1      ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
NM_002037.5         ACCAAAGGTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTC
                    ************************************************************

HsCD00038596        AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
NM_153047.3         AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
XM_005266889.1      AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
XM_005266890.1      AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
XM_005266888.1      AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
XM_005266887.1      AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
NM_002037.5         AAACATTATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAG
                    ************************************************************

HsCD00038596        TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAGAGCTGCAGGTCTCTGCTGC
NM_153047.3         TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAAAGCTGATGGTTTGTGTTTT
XM_005266889.1      TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAGAGCTGCAGGTCTCTGCTGC
XM_005266890.1      TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAAAGCTGATGGTTTGTGTTTT
XM_005266888.1      TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAGAGCTGCAGGTCTCTGCTGC
XM_005266887.1      TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAGAGCTGCAGGTCTCTGCTGC
NM_002037.5         TTTGAAACACTTCAGCAGCTTGTACAACATTACTCAGAGAGAGCTGCAGGTCTCTGCTGC
                    ****************************************.*****.:*** * ** *  

HsCD00038596        CGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACC
NM_153047.3         AACTTAACTGTGATTG---------CATCGAGTTGTACCCCACAAACTTCTGGATTGGCT
XM_005266889.1      CGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACC
XM_005266890.1      AACTTAACTGTGATTG---------CATCGAGTTGTACCCCACAAACTTCTGGATTGGCT
XM_005266888.1      CGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACC
XM_005266887.1      CGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACC
NM_002037.5         CGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACC
                    ..* **. :** .             .: *. ::* .  .*. *:.  **** .::..* 

HsCD00038596        AAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGTTGATCAAGAGACTGGGAAATGGG
NM_153047.3         AAAGATGCTTGGGAAGTTGCACGTCGTTCGTTGTGTCTGGAGAAGAAGCTGGGTCAGGGG
XM_005266889.1      AAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGTTGATCAAGAGACTGGGAAATGGG
XM_005266890.1      AAAGATGCTTGGGAAGTTGCACGTCGTTCGTTGTGTCTGGAGAAGAAGCTGGGTCAGGGG
XM_005266888.1      AAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGTTGATCAAGAGACTGGGAAATGGG
XM_005266887.1      AAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGTTGATCAAGAGACTGGGAAATGGG
NM_002037.5         AAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGTTGATCAAGAGACTGGGAAATGGG
                    *******  ******.*  *:**: .:**  ** .  **.: ****..*****:.* ***

HsCD00038596        CAGTTTGGGGAAGTATGGATGGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
NM_153047.3         TGTTTCGCTGAAGTGTGGCTTGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
XM_005266889.1      CAGTTTGGGGAAGTATGGATGGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
XM_005266890.1      TGTTTCGCTGAAGTGTGGCTTGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
XM_005266888.1      CAGTTTGGGGAAGTATGGATGGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
XM_005266887.1      CAGTTTGGGGAAGTATGGATGGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
NM_002037.5         CAGTTTGGGGAAGTATGGATGGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACT
                     . ** *  *****.***.* ***************************************

HsCD00038596        CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
NM_153047.3         CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
XM_005266889.1      CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
XM_005266890.1      CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
XM_005266888.1      CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
XM_005266887.1      CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
NM_002037.5         CTTAAACCAGGCACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAG
                    ************************************************************

HsCD00038596        CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
NM_153047.3         CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
XM_005266889.1      CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
XM_005266890.1      CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
XM_005266888.1      CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
XM_005266887.1      CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
NM_002037.5         CTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATC
                    ************************************************************

HsCD00038596        GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
NM_153047.3         GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
XM_005266889.1      GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
XM_005266890.1      GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
XM_005266888.1      GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
XM_005266887.1      GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
NM_002037.5         GTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGA
                    ************************************************************

HsCD00038596        GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
NM_153047.3         GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
XM_005266889.1      GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
XM_005266890.1      GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
XM_005266888.1      GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
XM_005266887.1      GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
NM_002037.5         GCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTAC
                    ************************************************************

HsCD00038596        ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
NM_153047.3         ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
XM_005266889.1      ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
XM_005266890.1      ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
XM_005266888.1      ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
XM_005266887.1      ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
NM_002037.5         ATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAAT
                    ************************************************************

HsCD00038596        GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
NM_153047.3         GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
XM_005266889.1      GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
XM_005266890.1      GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
XM_005266888.1      GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
XM_005266887.1      GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
NM_002037.5         GGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTAC
                    ************************************************************

HsCD00038596        ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
NM_153047.3         ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
XM_005266889.1      ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
XM_005266890.1      ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
XM_005266888.1      ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
XM_005266887.1      ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
NM_002037.5         ACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTAC
                    ************************************************************

HsCD00038596        GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
NM_153047.3         GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
XM_005266889.1      GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
XM_005266890.1      GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
XM_005266888.1      GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
XM_005266887.1      GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
NM_002037.5         GGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTC
                    ************************************************************

HsCD00038596        ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
NM_153047.3         ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
XM_005266889.1      ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
XM_005266890.1      ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
XM_005266888.1      ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
XM_005266887.1      ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
NM_002037.5         ACCAAAGGAAGAGTGCCATACCCAGGCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAG
                    ************************************************************

HsCD00038596        CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
NM_153047.3         CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
XM_005266889.1      CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
XM_005266890.1      CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
XM_005266888.1      CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
XM_005266887.1      CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
NM_002037.5         CGAGGCTACAGGATGCCCTGCCCGCAGGACTGCCCCATCTCTCTGCATGAGCTCATGATC
                    ************************************************************

HsCD00038596        CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
NM_153047.3         CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
XM_005266889.1      CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
XM_005266890.1      CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
XM_005266888.1      CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
XM_005266887.1      CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
NM_002037.5         CACTGCTGGAAAAAGGACCCTGAAGAACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTG
                    ************************************************************

HsCD00038596        GAAGACTACTTTACCGCGACAGAGCCCCAGTACAAACCTGGTGAAAACCTGTTG
NM_153047.3         GAAGACTACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAA
XM_005266889.1      GAAGACTACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAA
XM_005266890.1      GAAGACTACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAA
XM_005266888.1      GAAGACTACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAA
XM_005266887.1      GAAGACTACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAA
NM_002037.5         GAAGACTACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAA
                    *********************************.******************:.

Pathways

NCI : Alpha-synuclein signaling
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : EPHA forward signaling
NCI : Ephrin A reverse signaling
NCI : Ephrin B reverse signaling
NCI : ErbB4 signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : Glypican 1 network
NCI : IL2-mediated signaling events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Netrin-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Reelin signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Syndecan-3-mediated signaling events
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Axon guidance mediated by semaphorins
Panther : Cadherin signaling pathway
Panther : Integrin signalling pathway
Panther : Parkinson disease
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Axon guidance
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CD28 dependent Vav1 pathway
Reactome : CRMPs in Sema3A signaling
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DCC mediated attractive signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FCGR activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GPVI-mediated activation cascade
Reactome : HIV Infection
Reactome : Hemostasis
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nef and signal transduction
Reactome : Nephrin interactions
Reactome : Netrin mediated repulsion signals
Reactome : Netrin-1 signaling
Reactome : PECAM1 interactions
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet Adhesion to exposed collagen
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SEMA3A-Plexin repulsion signaling by inhibiting Integrin adhesion
Reactome : Sema3A PAK dependent Axon repulsion
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : TCR Signaling Pathway

Clone

Cloning Information : 205516
HIP Master Clone ID : 136805
Original Clone ID : FLH205516.01L

Organism


TAX_ID : 9606
Species Specific ID: 2534

Genome

Chromosome : 6
Map Location : 6q21
Ensembl : ENSG00000010810

Reagents

Labome : Fyn-antibody