DNASU Plasmid Repository • 480.965.5697 | Email

PIK3C3 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3C3
Gene Name:  phosphatidylinositol 3-kinase, catalytic subunit type 3
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH167016.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00039398

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2664nts         Open reading frame : 1 to 2664
Reference Sequence Alignment

ATGGGGGAAGCAGAGAAGTTTCACTACATCTATAGTTGTGACCTGGATATCAACGTCCAG
CTTAAGATAGGAAGCTTGGAAGGGAAGAGAGAACAAAAGAGTTATAAAGCTGTCCTGGAA
GACCCAATGTTGAAGTTCTCAGGACTATATCAAGAGACATGCTCTGATCTTTATGTTACT
TGTCAAGTTTTTGCAGAAGGGAAGCCTTTGGCCTTGCCAGTGAGAACATCCTACAAAGCA
TTTAGTACAAGATGGAACTGGAATGAATGGCTGAAACTACCAGTAAAATACCCTGACCTG
CCCAGGAATGCCCAAGTGGCCCTCACCATATGGGATGTGTATGGTCCCGGAAAAGCAGTG
CCTGTAGGAGGAACAACGGTTTCGCTCTTTGGAAAATACGGCATGTTTCGCCAAGGGATG
CATGACTTGAAAGTCTGGCCTAATGTAGAAGCAGATGGATCAGAACCCACAAAAACTCCT
GGCAGAACAAGTAGCACTCTCTCAGAAGATCAGATGAGCCGTCTTGCCAAGCTCACCAAA
GCTCATCGACAAGGACACATGGTGAAAGTAGATTGGCTGGATAGATTGACATTTAGAGAA
ATAGAAATGATAAATGAGAGTGAAAAACGAAGTTCTAATTTCATGTACCTGATGGTTGAA
TTTCGATGTGTCAAGTGTGATGATAAGGAATATGGTATTGTTTATTATGAAAAGGACGGT
GATGAATCATCTCCAATTTTAACAAGTTTTGAATTAGTGAAAGTTCCTGACCCCCAGATG
TCTATGGAGAATTTAGTTGAGAGCAAACACCACAAGCTTGCCCGGAGTTTAAGAAGTGGA
CCTTCTGACCACGATCTGAAACCCAATGCTGCCACGAGAGATCAGTTAAATATTATTGTG
AGTTATCCACCAACCAAGCAACTTACATATGAAGAACAAGATCTTGTTTGGAAGTTTAGA
TATTATCTTACGAATCAAGAAAAAGCCTTGACAAAATTCTTGAAATGTGTTAATTGGGAT
CTACCTCAAGAGGCCAAACAGGCCTTGGAACTTCTGGGAAAATGGAAGCCGATGGATGTA
GAGGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCT
GTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATGTACCTATTACAATTGGTC
CAGGCTCTCAAATATGAAAATTTTGATGATATAAAGAATGGATTGGAACCTACCAAGAAG
GATAGTCAGAGTTCAGTGTCAGAAAATGTGTCAAATTCTGGAATAAATTCTGCAGAAATA
GATAGCTCCCAAATTATAACCAGCCCCCTTCCTTCAGTCTCTTCACCTCCTCCTGCATCA
AAAACAAAAGAAGTTCCAGATGGCGAAAATCTGGAACAAGATCTCTGTACCTTCTTGATA
TCGAGAGCCTGCAAAAACTCAACACTGGCTAATTATTTATACTGGTATGTGATAGTGGAA
TGTGAAGATCAAGATACTCAGCAGAGAGATCCAAAGACCCATGAGATGTACTTGAACGTA
ATGAGAAGATTCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCT
TTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAA
CGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAAT
GAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAA
ATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAG
TTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGAT
TTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGGAAA
GAAAATCTGGACTTGAAATTGACACCTTATAAGGTGTTAGCCACCAGTACAAAACATGGC
TTCATGCAGTTTATCCAGTCAGTTCCTGTGGCTGAAGTTCTTGATACAGAGGGAAGCATT
CAGAACTTTTTTAGAAAATATGCACCAAGTGAGAATGGGCCAAATGGGATTAGTGCTGAG
GTCATGGACACTTACGTTAAAAGCTGTGCTGGATATTGCGTGATCACCTATATACTTGGA
GTTGGAGACAGGCACCTGGATAACCTTTTGCTAACAAAAACAGGCAAACTCTTCCACATA
GACTTTGGATATATTTTGGGTCGGGATCCAAAGCCTCTTCCTCCACCAATGAAGCTGAAT
AAAGAAATGGTAGAAGGAATGGGGGGCACACAGAGTGAGCAGTACCAAGAGTTCCGTAAA
CAGTGTTACACGGCTTTCCTCCACCTGCGAAGGTATTCTAATCTGATTTTGAACTTGTTT
TCCTTGATGGTTGATGCAAACATTCCAGATATTGCACTTGAACCAGATAAAACTGTGAAA
AAGGTTCAGGATAAATTCCGCTTAGACCTGTCGGATGAAGAGGCTGTGCATTACATGCAG
AGTCTGATTGATGAGAGTGTCCATGCTCTTTTTGCTGCAGTGGTGGAACAGATTCACAAG
TTTGCCCAGTACTGGAGAAAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2713
Start on reference sequence 50
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3C3
Symbol Nomenclature : PIK3C3
SYNONYM : VPS34; hVps34
Designation : PI3-kinase type 3|PI3K type 3|PtdIns-3-kinase type 3|phosphatidylinositol 3-kinase catalytic subunit type 3|phosphatidylinositol 3-kinase p100 subunit|phosphoinositide-3-kinase, class 3
Full Nomenclature : phosphatidylinositol 3-kinase, catalytic subunit type 3
GENEID : 5289
HGNC : 8974
MIM : 602609
Target GenBank: BC033004

 

Reference Sequence Alignment

  

HsCD00039398      ATGGGGGAAGCAGAGAAGTTTCACTACATCTATAGTTGTGACCTGGATATCAACGTCCAG
NM_002647.2       ATGGGGGAAGCAGAGAAGTTTCACTACATCTATAGTTGTGACCTGGATATCAACGTCCAG
                  ************************************************************

HsCD00039398      CTTAAGATAGGAAGCTTGGAAGGGAAGAGAGAACAAAAGAGTTATAAAGCTGTCCTGGAA
NM_002647.2       CTTAAGATAGGAAGCTTGGAAGGGAAGAGAGAACAAAAGAGTTATAAAGCTGTCCTGGAA
                  ************************************************************

HsCD00039398      GACCCAATGTTGAAGTTCTCAGGACTATATCAAGAGACATGCTCTGATCTTTATGTTACT
NM_002647.2       GACCCAATGTTGAAGTTCTCAGGACTATATCAAGAGACATGCTCTGATCTTTATGTTACT
                  ************************************************************

HsCD00039398      TGTCAAGTTTTTGCAGAAGGGAAGCCTTTGGCCTTGCCAGTGAGAACATCCTACAAAGCA
NM_002647.2       TGTCAAGTTTTTGCAGAAGGGAAGCCTTTGGCCTTGCCAGTGAGAACATCCTACAAAGCA
                  ************************************************************

HsCD00039398      TTTAGTACAAGATGGAACTGGAATGAATGGCTGAAACTACCAGTAAAATACCCTGACCTG
NM_002647.2       TTTAGTACAAGATGGAACTGGAATGAATGGCTGAAACTACCAGTAAAATACCCTGACCTG
                  ************************************************************

HsCD00039398      CCCAGGAATGCCCAAGTGGCCCTCACCATATGGGATGTGTATGGTCCCGGAAAAGCAGTG
NM_002647.2       CCCAGGAATGCCCAAGTGGCCCTCACCATATGGGATGTGTATGGTCCCGGAAAAGCAGTG
                  ************************************************************

HsCD00039398      CCTGTAGGAGGAACAACGGTTTCGCTCTTTGGAAAATACGGCATGTTTCGCCAAGGGATG
NM_002647.2       CCTGTAGGAGGAACAACGGTTTCGCTCTTTGGAAAATACGGCATGTTTCGCCAAGGGATG
                  ************************************************************

HsCD00039398      CATGACTTGAAAGTCTGGCCTAATGTAGAAGCAGATGGATCAGAACCCACAAAAACTCCT
NM_002647.2       CATGACTTGAAAGTCTGGCCTAATGTAGAAGCAGATGGATCAGAACCCACAAAAACTCCT
                  ************************************************************

HsCD00039398      GGCAGAACAAGTAGCACTCTCTCAGAAGATCAGATGAGCCGTCTTGCCAAGCTCACCAAA
NM_002647.2       GGCAGAACAAGTAGCACTCTCTCAGAAGATCAGATGAGCCGTCTTGCCAAGCTCACCAAA
                  ************************************************************

HsCD00039398      GCTCATCGACAAGGACACATGGTGAAAGTAGATTGGCTGGATAGATTGACATTTAGAGAA
NM_002647.2       GCTCATCGACAAGGACACATGGTGAAAGTAGATTGGCTGGATAGATTGACATTTAGAGAA
                  ************************************************************

HsCD00039398      ATAGAAATGATAAATGAGAGTGAAAAACGAAGTTCTAATTTCATGTACCTGATGGTTGAA
NM_002647.2       ATAGAAATGATAAATGAGAGTGAAAAACGAAGTTCTAATTTCATGTACCTGATGGTTGAA
                  ************************************************************

HsCD00039398      TTTCGATGTGTCAAGTGTGATGATAAGGAATATGGTATTGTTTATTATGAAAAGGACGGT
NM_002647.2       TTTCGATGTGTCAAGTGTGATGATAAGGAATATGGTATTGTTTATTATGAAAAGGACGGT
                  ************************************************************

HsCD00039398      GATGAATCATCTCCAATTTTAACAAGTTTTGAATTAGTGAAAGTTCCTGACCCCCAGATG
NM_002647.2       GATGAATCATCTCCAATTTTAACAAGTTTTGAATTAGTGAAAGTTCCTGACCCCCAGATG
                  ************************************************************

HsCD00039398      TCTATGGAGAATTTAGTTGAGAGCAAACACCACAAGCTTGCCCGGAGTTTAAGAAGTGGA
NM_002647.2       TCTATGGAGAATTTAGTTGAGAGCAAACACCACAAGCTTGCCCGGAGTTTAAGAAGTGGA
                  ************************************************************

HsCD00039398      CCTTCTGACCACGATCTGAAACCCAATGCTGCCACGAGAGATCAGTTAAATATTATTGTG
NM_002647.2       CCTTCTGACCACGATCTGAAACCCAATGCTGCCACGAGAGATCAGTTAAATATTATTGTG
                  ************************************************************

HsCD00039398      AGTTATCCACCAACCAAGCAACTTACATATGAAGAACAAGATCTTGTTTGGAAGTTTAGA
NM_002647.2       AGTTATCCACCAACCAAGCAACTTACATATGAAGAACAAGATCTTGTTTGGAAGTTTAGA
                  ************************************************************

HsCD00039398      TATTATCTTACGAATCAAGAAAAAGCCTTGACAAAATTCTTGAAATGTGTTAATTGGGAT
NM_002647.2       TATTATCTTACGAATCAAGAAAAAGCCTTGACAAAATTCTTGAAATGTGTTAATTGGGAT
                  ************************************************************

HsCD00039398      CTACCTCAAGAGGCCAAACAGGCCTTGGAACTTCTGGGAAAATGGAAGCCGATGGATGTA
NM_002647.2       CTACCTCAAGAGGCCAAACAGGCCTTGGAACTTCTGGGAAAATGGAAGCCGATGGATGTA
                  ************************************************************

HsCD00039398      GAGGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCT
NM_002647.2       GAGGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCT
                  ************************************************************

HsCD00039398      GTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATGTACCTATTACAATTGGTC
NM_002647.2       GTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATGTACCTATTACAATTGGTC
                  ************************************************************

HsCD00039398      CAGGCTCTCAAATATGAAAATTTTGATGATATAAAGAATGGATTGGAACCTACCAAGAAG
NM_002647.2       CAGGCTCTCAAATATGAAAATTTTGATGATATAAAGAATGGATTGGAACCTACCAAGAAG
                  ************************************************************

HsCD00039398      GATAGTCAGAGTTCAGTGTCAGAAAATGTGTCAAATTCTGGAATAAATTCTGCAGAAATA
NM_002647.2       GATAGTCAGAGTTCAGTGTCAGAAAATGTGTCAAATTCTGGAATAAATTCTGCAGAAATA
                  ************************************************************

HsCD00039398      GATAGCTCCCAAATTATAACCAGCCCCCTTCCTTCAGTCTCTTCACCTCCTCCTGCATCA
NM_002647.2       GATAGCTCCCAAATTATAACCAGCCCCCTTCCTTCAGTCTCTTCACCTCCTCCTGCATCA
                  ************************************************************

HsCD00039398      AAAACAAAAGAAGTTCCAGATGGCGAAAATCTGGAACAAGATCTCTGTACCTTCTTGATA
NM_002647.2       AAAACAAAAGAAGTTCCAGATGGCGAAAATCTGGAACAAGATCTCTGTACCTTCTTGATA
                  ************************************************************

HsCD00039398      TCGAGAGCCTGCAAAAACTCAACACTGGCTAATTATTTATACTGGTATGTGATAGTGGAA
NM_002647.2       TCGAGAGCCTGCAAAAACTCAACACTGGCTAATTATTTATACTGGTATGTGATAGTGGAA
                  ************************************************************

HsCD00039398      TGTGAAGATCAAGATACTCAGCAGAGAGATCCAAAGACCCATGAGATGTACTTGAACGTA
NM_002647.2       TGTGAAGATCAAGATACTCAGCAGAGAGATCCAAAGACCCATGAGATGTACTTGAACGTA
                  ************************************************************

HsCD00039398      ATGAGAAGATTCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCT
NM_002647.2       ATGAGAAGATTCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCT
                  ************************************************************

HsCD00039398      TTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAA
NM_002647.2       TTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAA
                  ************************************************************

HsCD00039398      CGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAAT
NM_002647.2       CGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAAT
                  ************************************************************

HsCD00039398      GAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAA
NM_002647.2       GAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAA
                  ************************************************************

HsCD00039398      ATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAG
NM_002647.2       ATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAG
                  ************************************************************

HsCD00039398      TTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGAT
NM_002647.2       TTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGAT
                  ************************************************************

HsCD00039398      TTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGGAAA
NM_002647.2       TTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGGAAA
                  ************************************************************

HsCD00039398      GAAAATCTGGACTTGAAATTGACACCTTATAAGGTGTTAGCCACCAGTACAAAACATGGC
NM_002647.2       GAAAATCTGGACTTGAAATTGACACCTTATAAGGTGTTAGCCACCAGTACAAAACATGGC
                  ************************************************************

HsCD00039398      TTCATGCAGTTTATCCAGTCAGTTCCTGTGGCTGAAGTTCTTGATACAGAGGGAAGCATT
NM_002647.2       TTCATGCAGTTTATCCAGTCAGTTCCTGTGGCTGAAGTTCTTGATACAGAGGGAAGCATT
                  ************************************************************

HsCD00039398      CAGAACTTTTTTAGAAAATATGCACCAAGTGAGAATGGGCCAAATGGGATTAGTGCTGAG
NM_002647.2       CAGAACTTTTTTAGAAAATATGCACCAAGTGAGAATGGGCCAAATGGGATTAGTGCTGAG
                  ************************************************************

HsCD00039398      GTCATGGACACTTACGTTAAAAGCTGTGCTGGATATTGCGTGATCACCTATATACTTGGA
NM_002647.2       GTCATGGACACTTACGTTAAAAGCTGTGCTGGATATTGCGTGATCACCTATATACTTGGA
                  ************************************************************

HsCD00039398      GTTGGAGACAGGCACCTGGATAACCTTTTGCTAACAAAAACAGGCAAACTCTTCCACATA
NM_002647.2       GTTGGAGACAGGCACCTGGATAACCTTTTGCTAACAAAAACAGGCAAACTCTTCCACATA
                  ************************************************************

HsCD00039398      GACTTTGGATATATTTTGGGTCGGGATCCAAAGCCTCTTCCTCCACCAATGAAGCTGAAT
NM_002647.2       GACTTTGGATATATTTTGGGTCGGGATCCAAAGCCTCTTCCTCCACCAATGAAGCTGAAT
                  ************************************************************

HsCD00039398      AAAGAAATGGTAGAAGGAATGGGGGGCACACAGAGTGAGCAGTACCAAGAGTTCCGTAAA
NM_002647.2       AAAGAAATGGTAGAAGGAATGGGGGGCACACAGAGTGAGCAGTACCAAGAGTTCCGTAAA
                  ************************************************************

HsCD00039398      CAGTGTTACACGGCTTTCCTCCACCTGCGAAGGTATTCTAATCTGATTTTGAACTTGTTT
NM_002647.2       CAGTGTTACACGGCTTTCCTCCACCTGCGAAGGTATTCTAATCTGATTTTGAACTTGTTT
                  ************************************************************

HsCD00039398      TCCTTGATGGTTGATGCAAACATTCCAGATATTGCACTTGAACCAGATAAAACTGTGAAA
NM_002647.2       TCCTTGATGGTTGATGCAAACATTCCAGATATTGCACTTGAACCAGATAAAACTGTGAAA
                  ************************************************************

HsCD00039398      AAGGTTCAGGATAAATTCCGCTTAGACCTGTCGGATGAAGAGGCTGTGCATTACATGCAG
NM_002647.2       AAGGTTCAGGATAAATTCCGCTTAGACCTGTCGGATGAAGAGGCTGTGCATTACATGCAG
                  ************************************************************

HsCD00039398      AGTCTGATTGATGAGAGTGTCCATGCTCTTTTTGCTGCAGTGGTGGAACAGATTCACAAG
NM_002647.2       AGTCTGATTGATGAGAGTGTCCATGCTCTTTTTGCTGCAGTGGTGGAACAGATTCACAAG
                  ************************************************************

HsCD00039398      TTTGCCCAGTACTGGAGAAAATTG
NM_002647.2       TTTGCCCAGTACTGGAGAAAATGA
                  ********************** .

Pathways

Panther : Angiogenesis
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PI Metabolism
Reactome : PI3K Cascade
Reactome : Phospholipid metabolism
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Synthesis of PIPs at the Golgi membrane
Reactome : Synthesis of PIPs at the early endosome membrane
Reactome : Synthesis of PIPs at the late endosome membrane
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : AMPK signaling
WikiPathway : Insulin Signaling
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Senescence and Autophagy

Clone

Cloning Information : 167016
HIP Master Clone ID : 140180
Original Clone ID : FLH167016.01L

Organism


TAX_ID : 9606
Species Specific ID: 5289

Genome

Chromosome : 18
Map Location : 18q12.3

Reagents

Labome : PIK3C3-antibody