DNASU Plasmid Repository • 480.965.5697 | Email

CDK2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK2
Gene Name:  cyclin-dependent kinase 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH164342.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 24304893
Title: DICE, an efficient system for iterative genomic editing in human pluripotent stem cells
Authors: HIP
HsCD00039453

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 897nts         Open reading frame : 1 to 897

ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAA
GCCAGAAACAAGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACTGAG
ACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGATCTCTCTGCTTAAGGAGCTTAACCAT
CCTAATATTGTCAAGCTGCTGGATGTCATTCACACAGAAAATAAACTCTACCTGGTTTTT
GAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTCACTGGCATTCCT
CTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATTCT
CATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCC
ATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACC
CATGAGGTGGTGACCCTGTGGTACCGAGCTCCTGAAATCCTCCTGGGCTGCAAATATTAT
TCCACAGCTGTGGACATCTGGAGCCTGGGCTGCATCTTTGCTGAGATGGTGACTCGCCGG
GCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGATCTTTCGGACTCTGGGG
ACCCCAGATGAGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTC
CCCAAGTGGGCCCGGCAAGATTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGGACGG
AGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCC
CTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1066
Start on reference sequence 170
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK2
Symbol Nomenclature : CDK2
SYNONYM : p33(CDK2)
Designation : cdc2-related protein kinase|cell devision kinase 2|cell division protein kinase 2|p33 protein kinase
Full Nomenclature : cyclin-dependent kinase 2
GENEID : 1017
HGNC : 1771
MIM : 116953
Vega : OTTHUMG00000170575
Target GenBank: BC003065

 

Pathways

NCI : ATR signaling pathway
NCI : BARD1 signaling events
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : FoxO family signaling
NCI : IL2-mediated signaling events
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by PRL
NCI : mTOR signaling pathway
NCI : p53 pathway
NCI : p73 transcription factor network
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G0 and Early G1
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : G2 Phase
Reactome : G2/M Checkpoints
Reactome : G2/M Transition
Reactome : Hemostasis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Orc1 removal from chromatin
Reactome : Phosphorylation of proteins involved in G1/S transition by active Cyclin E:Cdk2 complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of DNA replication
Reactome : Regulation of mitotic cell cycle
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA Replication
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : ID signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 164342
HIP Master Clone ID : 137542
Original Clone ID : FLH164342.01L

Organism


TAX_ID : 9606
Species Specific ID: 1017

Genome

Chromosome : 12
Map Location : 12q13
Ensembl : ENSG00000123374

Reagents

Labome : CDK2-antibody