DNASU Plasmid Repository • 480.965.5697 | Email

PRKAB2 (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKAB2
Gene Name:  protein kinase, AMP-activated, beta 2 non-catalytic subunit
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100072255)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00398759

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 816nts        
Open reading frame : 1 to 816
Reference Sequence Alignment

ATGGGAAACACCACCAGCGACCGGGTGTCCGGGGAGCGCCACGGCGCCAAGGCTGCACGC
TCCGAGGGCGCAGGCGGCCATGCCCCGGGGAAGGAGCACAAGATCATGGTGGGGAGTACG
GACGACCCCAGCGTGTTCAGCCTCCCTGACTCCAAGCTCCCTGGGGACAAAGAGTTTGTA
TCATGGCAGCAGGATTTGGAGGACTCCGTAAAGCCCACACAGCAGGCCCGGCCCACTGTT
ATCCGCTGGTCTGAAGGAGGCAAGGAGGTCTTCATCTCTGGGTCCTTCAACAATTGGAGC
ACCAAGATTCCACTGATTAAGAGCCATAATGACTTTGTTGCCATCCTGGACCTCCCTGAG
GGAGAGCACCAATACAAGTTCTTTGTGGATGGACAGTGGGTTCATGATCCATCAGAGCCT
GTGGTTACCAGTCAGCTTGGCACAATTAACAATTTGATCCATGTCAAGAAATCTGATTTT
GAGGTGTTCGATGCTTTAAAGTTAGATTCTATGGAAAGTTCTGAGACATCTTGTAGAGAC
CTTTCCAGCTCACCCCCAGGGCCTTATGGTCAAGAAATGTATGCGTTTCGATCTGAGGAA
AGATTCAAATCCCCACCCATCCTTCCTCCTCATCTACTTCAAGTTATTCTTAACAAAGAC
ACTAATATTTCTTGTGACCCAGCCTTACTCCCTGAGCCCAACCATGTTATGCTGAACCAT
CTCTATGCATTGTCCATTAAGGACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAG
AAGAAGTATGTTACTACTCTGCTATACAAGCCCATT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKAB2
Symbol Nomenclature : PRKAB2
Designation : 5'-AMP-activated protein kinase subunit beta-2|5'-AMP-activated protein kinase, beta-2 subunit|AMPK beta 2|AMPK beta-2 chain|AMPK subunit beta-2
Full Nomenclature : protein kinase, AMP-activated, beta 2 non-catalytic subunit
GENEID : 5565
GenBank Accession : HQ257946
HGNC : 9379
MIM : 602741
Vega : OTTHUMG00000014032
Target GenBank: HQ257946

 

Reference Sequence Alignment

  

HsCD00398759      ATGGGAAACACCACCAGCGACCGGGTGTCCGGGGAGCGCCACGGCGCCAAGGCTGCACGC
NM_005399.4       ATGGGAAACACCACCAGCGACCGGGTGTCCGGGGAGCGCCACGGCGCCAAGGCTGCACGC
                  ************************************************************

HsCD00398759      TCCGAGGGCGCAGGCGGCCATGCCCCGGGGAAGGAGCACAAGATCATGGTGGGGAGTACG
NM_005399.4       TCCGAGGGCGCAGGCGGCCATGCCCCGGGGAAGGAGCACAAGATCATGGTGGGGAGTACG
                  ************************************************************

HsCD00398759      GACGACCCCAGCGTGTTCAGCCTCCCTGACTCCAAGCTCCCTGGGGACAAAGAGTTTGTA
NM_005399.4       GACGACCCCAGCGTGTTCAGCCTCCCTGACTCCAAGCTCCCTGGGGACAAAGAGTTTGTA
                  ************************************************************

HsCD00398759      TCATGGCAGCAGGATTTGGAGGACTCCGTAAAGCCCACACAGCAGGCCCGGCCCACTGTT
NM_005399.4       TCATGGCAGCAGGATTTGGAGGACTCCGTAAAGCCCACACAGCAGGCCCGGCCCACTGTT
                  ************************************************************

HsCD00398759      ATCCGCTGGTCTGAAGGAGGCAAGGAGGTCTTCATCTCTGGGTCCTTCAACAATTGGAGC
NM_005399.4       ATCCGCTGGTCTGAAGGAGGCAAGGAGGTCTTCATCTCTGGGTCCTTCAACAATTGGAGC
                  ************************************************************

HsCD00398759      ACCAAGATTCCACTGATTAAGAGCCATAATGACTTTGTTGCCATCCTGGACCTCCCTGAG
NM_005399.4       ACCAAGATTCCACTGATTAAGAGCCATAATGACTTTGTTGCCATCCTGGACCTCCCTGAG
                  ************************************************************

HsCD00398759      GGAGAGCACCAATACAAGTTCTTTGTGGATGGACAGTGGGTTCATGATCCATCAGAGCCT
NM_005399.4       GGAGAGCACCAATACAAGTTCTTTGTGGATGGACAGTGGGTTCATGATCCATCAGAGCCT
                  ************************************************************

HsCD00398759      GTGGTTACCAGTCAGCTTGGCACAATTAACAATTTGATCCATGTCAAGAAATCTGATTTT
NM_005399.4       GTGGTTACCAGTCAGCTTGGCACAATTAACAATTTGATCCATGTCAAGAAATCTGATTTT
                  ************************************************************

HsCD00398759      GAGGTGTTCGATGCTTTAAAGTTAGATTCTATGGAAAGTTCTGAGACATCTTGTAGAGAC
NM_005399.4       GAGGTGTTCGATGCTTTAAAGTTAGATTCTATGGAAAGTTCTGAGACATCTTGTAGAGAC
                  ************************************************************

HsCD00398759      CTTTCCAGCTCACCCCCAGGGCCTTATGGTCAAGAAATGTATGCGTTTCGATCTGAGGAA
NM_005399.4       CTTTCCAGCTCACCCCCAGGGCCTTATGGTCAAGAAATGTATGCGTTTCGATCTGAGGAA
                  ************************************************************

HsCD00398759      AGATTCAAATCCCCACCCATCCTTCCTCCTCATCTACTTCAAGTTATTCTTAACAAAGAC
NM_005399.4       AGATTCAAATCCCCACCCATCCTTCCTCCTCATCTACTTCAAGTTATTCTTAACAAAGAC
                  ************************************************************

HsCD00398759      ACTAATATTTCTTGTGACCCAGCCTTACTCCCTGAGCCCAACCATGTTATGCTGAACCAT
NM_005399.4       ACTAATATTTCTTGTGACCCAGCCTTACTCCCTGAGCCCAACCATGTTATGCTGAACCAT
                  ************************************************************

HsCD00398759      CTCTATGCATTGTCCATTAAGGACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAG
NM_005399.4       CTCTATGCATTGTCCATTAAGGACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAG
                  ************************************************************

HsCD00398759      AAGAAGTATGTTACTACTCTGCTATACAAGCCCATT---
NM_005399.4       AAGAAGTATGTTACTACTCTGCTATACAAGCCCATTTGA
                  ************************************   

Pathways

Panther : p53 pathway by glucose deprivation
Reactome : Activation of PPARGC1A (PGC-1alpha) by phosphorylation
Reactome : AMPK inhibits chREBP transcriptional activation activity
Reactome : Energy dependent regulation of mTOR by LKB1-AMPK
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : IGF1R signaling cascade
Reactome : Import of palmitoyl-CoA into the mitochondrial matrix
Reactome : Insulin receptor signalling cascade
Reactome : Integration of energy metabolism
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Mitochondrial biogenesis
Reactome : mTOR signalling
Reactome : Organelle biogenesis and maintenance
Reactome : PI3K Cascade
Reactome : PKB-mediated events
Reactome : Regulation of AMPK activity via LKB1
Reactome : Regulation of Rheb GTPase activity by AMPK
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Translocation of GLUT4 to the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : Energy Metabolism
WikiPathway : TOR signaling

Clone

Cloning Information : 571297

Organism


TAX_ID : 9606
Species Specific ID: 5565

Genome

Chromosome : 1
Map Location : 1q21.1
Ensembl : ENSG00000131791

Reagents

Labome : PRKAB2-antibody