DNASU Plasmid Repository • 480.965.5697 | Email

SRC (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SRC
Gene Name:  v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Sequence              Map: pANT7_cGST.doc
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: generated from ORFeome entry clone (IMAGE:100073560)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00404389

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1608nts         Open reading frame : 51 to 1658
Reference Sequence Alignment

TCCATTAGGGATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCATGGGTAGCA
ACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCCGCCGAGAACG
TGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAGCCAGCCTCGG
CCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAGCCCAAGCTGT
TCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGCCCGCTGGCCG
GTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAGACAGACCTGT
CCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGACTGGTGGCTGG
CCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTGGCGCCCTCCG
ACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAGTCAGAGCGGT
TACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGTGAGACCACGA
AAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTCAACGTGAAGC
ACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGCACCCAGTTCA
ACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTGTGCCACCGCC
TCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAGGATGCCTGGG
AGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGCTTTGGCGAGG
TGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTGAAGCCTGGCA
CGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTGAGGCATGAGA
AGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTCACGGAGTACA
TGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTACCTGCGGCTGC
CTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTGGAGCGGATGA
ACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAACCTGGTGTGCA
AAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACGGCGCGGCAAG
GTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGCCGCTTCACCA
TCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACAAAGGGACGGG
TGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGGGGCTACCGGA
TGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAGTGCTGGCGGA
AGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAGGACTACTTCA
CGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTACCCAACTTTCTTGTACAAAG
TTGGCATTATAAGAAAGCATTGCTTATCAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SRC
Symbol Nomenclature : SRC
SYNONYM : ASV; SRC1; c-SRC; p60-Src
Designation : proto-oncogene c-Src|proto-oncogene tyrosine-protein kinase Src|protooncogene SRC, Rous sarcoma|tyrosine kinase pp60c-src|tyrosine-protein kinase SRC-1
Full Nomenclature : v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
GENEID : 6714
Locus Tag : RP5-823N20.1
GenBank Accession : JF432365
HGNC : 11283
MIM : 190090
Vega : OTTHUMG00000032417
Target GenBank: JF432365

 

Reference Sequence Alignment

  

HsCD00404389      TCCATTAGGGATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCATGGGTAGCA
NM_198291.2       --------------------------------------------------ATGGGTAGCA
NM_005417.4       --------------------------------------------------ATGGGTAGCA
                                                                    **********

HsCD00404389      ACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCCGCCGAGAACG
NM_198291.2       ACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCCGCCGAGAACG
NM_005417.4       ACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCCGCCGAGAACG
                  ************************************************************

HsCD00404389      TGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAGCCAGCCTCGG
NM_198291.2       TGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAGCCAGCCTCGG
NM_005417.4       TGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAGCCAGCCTCGG
                  ************************************************************

HsCD00404389      CCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAGCCCAAGCTGT
NM_198291.2       CCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAGCCCAAGCTGT
NM_005417.4       CCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAGCCCAAGCTGT
                  ************************************************************

HsCD00404389      TCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGCCCGCTGGCCG
NM_198291.2       TCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGCCCGCTGGCCG
NM_005417.4       TCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGCCCGCTGGCCG
                  ************************************************************

HsCD00404389      GTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAGACAGACCTGT
NM_198291.2       GTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAGACAGACCTGT
NM_005417.4       GTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAGACAGACCTGT
                  ************************************************************

HsCD00404389      CCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGACTGGTGGCTGG
NM_198291.2       CCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGACTGGTGGCTGG
NM_005417.4       CCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGACTGGTGGCTGG
                  ************************************************************

HsCD00404389      CCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTGGCGCCCTCCG
NM_198291.2       CCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTGGCGCCCTCCG
NM_005417.4       CCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTGGCGCCCTCCG
                  ************************************************************

HsCD00404389      ACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAGTCAGAGCGGT
NM_198291.2       ACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAGTCAGAGCGGT
NM_005417.4       ACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAGTCAGAGCGGT
                  ************************************************************

HsCD00404389      TACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGTGAGACCACGA
NM_198291.2       TACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGTGAGACCACGA
NM_005417.4       TACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGTGAGACCACGA
                  ************************************************************

HsCD00404389      AAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTCAACGTGAAGC
NM_198291.2       AAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTCAACGTGAAGC
NM_005417.4       AAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTCAACGTGAAGC
                  ************************************************************

HsCD00404389      ACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGCACCCAGTTCA
NM_198291.2       ACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGCACCCAGTTCA
NM_005417.4       ACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGCACCCAGTTCA
                  ************************************************************

HsCD00404389      ACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTGTGCCACCGCC
NM_198291.2       ACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTGTGCCACCGCC
NM_005417.4       ACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTGTGCCACCGCC
                  ************************************************************

HsCD00404389      TCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAGGATGCCTGGG
NM_198291.2       TCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAGGATGCCTGGG
NM_005417.4       TCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAGGATGCCTGGG
                  ************************************************************

HsCD00404389      AGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGCTTTGGCGAGG
NM_198291.2       AGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGCTTTGGCGAGG
NM_005417.4       AGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGCTTTGGCGAGG
                  ************************************************************

HsCD00404389      TGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTGAAGCCTGGCA
NM_198291.2       TGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTGAAGCCTGGCA
NM_005417.4       TGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTGAAGCCTGGCA
                  ************************************************************

HsCD00404389      CGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTGAGGCATGAGA
NM_198291.2       CGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTGAGGCATGAGA
NM_005417.4       CGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTGAGGCATGAGA
                  ************************************************************

HsCD00404389      AGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTCACGGAGTACA
NM_198291.2       AGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTCACGGAGTACA
NM_005417.4       AGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTCACGGAGTACA
                  ************************************************************

HsCD00404389      TGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTACCTGCGGCTGC
NM_198291.2       TGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTACCTGCGGCTGC
NM_005417.4       TGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTACCTGCGGCTGC
                  ************************************************************

HsCD00404389      CTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTGGAGCGGATGA
NM_198291.2       CTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTGGAGCGGATGA
NM_005417.4       CTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTGGAGCGGATGA
                  ************************************************************

HsCD00404389      ACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAACCTGGTGTGCA
NM_198291.2       ACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAACCTGGTGTGCA
NM_005417.4       ACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAACCTGGTGTGCA
                  ************************************************************

HsCD00404389      AAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACGGCGCGGCAAG
NM_198291.2       AAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACGGCGCGGCAAG
NM_005417.4       AAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACGGCGCGGCAAG
                  ************************************************************

HsCD00404389      GTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGCCGCTTCACCA
NM_198291.2       GTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGCCGCTTCACCA
NM_005417.4       GTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGCCGCTTCACCA
                  ************************************************************

HsCD00404389      TCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACAAAGGGACGGG
NM_198291.2       TCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACAAAGGGACGGG
NM_005417.4       TCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACAAAGGGACGGG
                  ************************************************************

HsCD00404389      TGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGGGGCTACCGGA
NM_198291.2       TGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGGGGCTACCGGA
NM_005417.4       TGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGGGGCTACCGGA
                  ************************************************************

HsCD00404389      TGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAGTGCTGGCGGA
NM_198291.2       TGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAGTGCTGGCGGA
NM_005417.4       TGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAGTGCTGGCGGA
                  ************************************************************

HsCD00404389      AGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAGGACTACTTCA
NM_198291.2       AGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAGGACTACTTCA
NM_005417.4       AGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAGGACTACTTCA
                  ************************************************************

HsCD00404389      CGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTACCCAACTTTCTTGTACAAAG
NM_198291.2       CGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTAG-------------------
NM_005417.4       CGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTAG-------------------
                  ****************************************                    

HsCD00404389      TTGGCATTATAAGAAAGCATTGCTTATCAA
NM_198291.2       ------------------------------
NM_005417.4       ------------------------------
                                                

Pathways

NCI : Alpha-synuclein signaling
NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Arf6 signaling events
NCI : Atypical NF-kappaB pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Class I PI3K signaling events mediated by Akt
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHA forward signaling
NCI : EPHA2 forward signaling
NCI : EPHB forward signaling
NCI : Endothelins
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Glypican 1 network
NCI : Integrins in angiogenesis
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Nectin adhesion pathway
NCI : Netrin-mediated signaling events
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Regulation of Androgen receptor activity
NCI : Regulation of p38-alpha and p38-beta
NCI : S1P3 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : amb2 Integrin signaling
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Integrin signalling pathway
Panther : Parkinson disease
Reactome : ADP signalling through P2Y purinoceptor 1
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CD28 co-stimulation
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Costimulation by the CD28 family
Reactome : DCC mediated attractive signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : FCGR activation
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GP1b-IX-V activation signalling
Reactome : GRB2:SOS provides linkage to MAPK signaling for Integrins
Reactome : Gap junction trafficking and regulation
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : L1CAM interactions
Reactome : Membrane Trafficking
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Netrin mediated repulsion signals
Reactome : Netrin-1 signaling
Reactome : PECAM1 interactions
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Recycling pathway of L1
Reactome : Regulation of KIT signaling
Reactome : Regulation of gap junction activity
Reactome : Signal Transduction
Reactome : Signal amplification
Reactome : Signal regulatory protein (SIRP) family interactions
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Spry regulation of FGF signaling
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : c-src mediated regulation of Cx43 function and closure of gap junctions
Reactome : p130Cas linkage to MAPK signaling for integrins
Reactome : p38MAPK events
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Angiogenesis
WikiPathway : EPO Receptor Signaling
WikiPathway : ErbB signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Notch Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 579326

Organism


TAX_ID : 9606
Species Specific ID: 6714

Genome

Chromosome : 20
Map Location : 20q12-q13
Ensembl : ENSG00000197122

Reagents

Labome : Src-antibody