DNASU Plasmid Repository • 480.965.5697 | Email

PRKAB2 (Homo sapiens) in pVP56K (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKAB2
Gene Name:  protein kinase, AMP-activated, beta 2 non-catalytic subunit
Sequence             
Original Clone ID: 2015.1.58_GO.33898
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pVP56K               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
HsCD00424445

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 825nts        
Open reading frame : 51 to 875

GTGCCGGGCTGGAAGTTCTGTTCCAGGGGCCCGAAAACCTGTACTTCCAGGCGATCGCCG
GAAACACCACCAGCGACCGGGTGTCCGGGGAGCGCCACGGCGCCAAGGCTGCACGCTCCG
AGGGCGCAGGCGGCCATGCCCCGGGGAAGGAGCACAAGATCATGGTGGGGAGTACGGACG
ACCCCAGCGTGTTCAGCCTCCCTGACTCCAAGCTCCCTGGGGACAAAGAGTTTGTATCAT
GGCAGCAGGATTTGGAGGACTCCGTAAAGCCCACACAGCAGGCCCGGCCCACTGTTATCC
GCTGGTCTGAAGGAGGCAAGGAGGTCTTCATCTCTGGGTCCTTCAACAATTGGAGCACCA
AGATTCCACTGATTAAGAGCCATAATGACTTTGTTGCCATCCTGGACCTCCCTGAGGGAG
AGCACCAATACAAGTTCTTTGTGGATGGACAGTGGGTTCATGATCCATCAGAGCCTGTGG
TTACCAGTCAGCTTGGCACAATTAACAATTTGATCCATGTCAAGAAATCTGATTTTGAGG
TGTTCGATGCTTTAAAGTTAGATTCTATGGAAAGTTCTGAGACATCTTGTAGAGACCTTT
CCAGCTCACCCCCAGGGCCTTATGGTCAAGAAATGTATGCGTTTCGATCTGAGGAAAGAT
TCAAATCCCCACCCATCCTTCCTCCTCATCTACTTCAAGTTATTCTTAACAAAGACACTA
ATATTTCTTGTGACCCAGCCTTACTCCCTGAGCCCAACCATGTTATGCTGAACCATCTCT
ATGCATTGTCCATTAAGGACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAGAAGA
AGTATGTTACTACTCTGCTATACAAGCCCATTTGATAGGTTTAAACGAATTCGAGCTCGG
TACCCGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinPurified: Not_Tested
ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
Find experimental protocols in GO.33898
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP56K

pVP56K in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  MBP Forward
Reverse:  T7 Terminator
Description: Bacterial (E. coli) expression, adds N-terminal 8xHis, MBP, 3CP cleavage, Tev cleavage; kanamycin resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte
Size (bp): 7253
Parent Vector: None
Empty Vector: EvNO00084282
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 16377204
Title: High efficiency single step production of expression plasmids from cDNA clones using the Flexi Vector cloning system

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 5502 6184
promoter T5 T5 promoter 123 169
protease cleavage site TEV TEV protease cleavage site 1413 1433
protease cleavage site 3C 3C protease cleavage site 1388 1412
repressor protein gene LacI LacI cds 3845 4924
selectable marker Barnase Barnase gene 1464 1800
selectable marker CmR Chlorampenicol resistance gene (CAT) 1903 2556
tag His 8xHis tag 237 260
tag MBP MBP tag 267 1363

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKAB2
Symbol Nomenclature : PRKAB2
Designation : 5'-AMP-activated protein kinase subunit beta-2|5'-AMP-activated protein kinase, beta-2 subunit|AMPK beta 2|AMPK beta-2 chain|AMPK subunit beta-2
Full Nomenclature : protein kinase, AMP-activated, beta 2 non-catalytic subunit
GENEID : 5565
GI : 31566345
GenBank Accession : BC053610
HGNC : 9379
MIM : 602741
Vega : OTTHUMG00000014032
Target GenBank: BC053610

 

Pathways

Panther : p53 pathway by glucose deprivation
Reactome : Activation of PPARGC1A (PGC-1alpha) by phosphorylation
Reactome : AMPK inhibits chREBP transcriptional activation activity
Reactome : Energy dependent regulation of mTOR by LKB1-AMPK
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : IGF1R signaling cascade
Reactome : Import of palmitoyl-CoA into the mitochondrial matrix
Reactome : Insulin receptor signalling cascade
Reactome : Integration of energy metabolism
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Mitochondrial biogenesis
Reactome : mTOR signalling
Reactome : Organelle biogenesis and maintenance
Reactome : PI3K Cascade
Reactome : PKB-mediated events
Reactome : Regulation of AMPK activity via LKB1
Reactome : Regulation of Rheb GTPase activity by AMPK
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Translocation of GLUT4 to the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : Energy Metabolism
WikiPathway : TOR signaling

Protein

SMART domain : AMPKBI : 5'-AMP-activated protein kinase beta subunit, interation domain
Structural Annotation Wiki : TOPSAN
HPRD : 04117

Clone

Cloning Information : 559111
HIP Master Clone ID : 469431
Original Clone ID : 2015.1.58_GO.33898

Experimental

TargetTrack - Experimental data : GO.33898

Organism


TAX_ID : 9606
Species Specific ID: 5565

Genome

Chromosome : 1
Map Location : 1q21.1
Ensembl : ENSG00000131791

Reagents

Labome : PRKAB2-antibody