DNASU Plasmid Repository • 480.965.5697 | Email

FAP (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FAP
Gene Name:  fibroblast activation protein, alpha
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH176795.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00043440

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2283nts        
Open reading frame : 1 to 2283
Reference Sequence Alignment

ATGAAGACTTGGGTAAAAATCGTATTTGGAGTTGCCACCTCTGCTGTGCTTGCCTTATTG
GTGATGTGCATTGTCTTACGCCCTTCAAGAGTTCATAACTCTGAAGAAAATACAATGAGA
GCACTCACACTGAAGGATATTTTAAATGGAACATTTTCTTATAAAACATTTTTTCCAAAC
TGGATTTCAGGACAAGAATATCTTCATCAATCTGCAGATAACAATATAGTACTTTATAAT
ATTGAAACAGGACAATCATATACCATTTTGAGTAATAGAACCATGAAAAGTGTGAATGCT
TCAAATTACGGCTTATCACCTGATCGGCAATTTGTATATCTAGAAAGTGATTATTCAAAG
CTTTGGAGATACTCTTACACAGCAACATATTACATCTATGACCTTAGCAATGGAGAATTT
GTAAGAGGAAATGAGCTTCCTCGTCCAATTCAGTATTTATGCTGGTCGCCTGTTGGGAGT
AAATTAGCATATGTCTATCAAAACAATATCTATTTGAAACAAAGACCAGGAGATCCACCT
TTTCAAATAACATTTAATGGAAGAGAAAATAAAATATTTAATGGAATCCCAGACTGGGTT
TATGAAGAGGAAATGCTTGCTACAAAATATGCTCTCTGGTGGTCTCCTAATGGAAAATTT
TTGGCATATGCGGAATTTAATGATACGGATATACCAGTTATTGCCTATTCCTATTATGGC
GATGAACAATATCCTAGAACAATAAATATTCCATACCCAAAGGCTGGAGCTAAGAATCCC
GTTGTTCGGATATTTATTATCGATACCACTTACCCTGCGTATGTAGGTCCCCAGGAAGTG
CCTGTTCCAGCAATGATAGCCTCAAGTGATTATTATTTCAGTTGGCTCACGTGGGTTACT
GATGAACGAGTATGTTTGCAGTGGCTAAAAAGAGTCCAGAATGTTTCGGTCCTGTCTATA
TGTGACTTCAGGGAAGACTGGCAGACATGGGATTGTCCAAAGACCCAGGAGCATATAGAA
GAAAGCAGAACTGGATGGGCTGGTGGATTCTTTGTTTCAACACCAGTTTTCAGCTATGAT
GCCATTTCGTACTACAAAATATTTAGTGACAAGGATGGCTACAAACATATTCACTATATC
AAAGACACTGTGGAAAATGCTATTCAAATTACAAGTGGCAAGTGGGAGGCCATAAATATA
TTCAGAGTAACACAGGATTCACTGTTTTATTCTAGCAATGAATTTGAAGAATACCCTGGA
AGAAGAAACATCTACAGAATTAGCATTGGAAGCTATCCTCCAAGCAAGAAGTGTGTTACT
TGCCATCTAAGGAAAGAAAGGTGCCAATATTACACAGCAAGTTTCAGCGACTACGCCAAG
TACTATGCACTTGTCTGCTACGGCCCAGGCATCCCCATTTCCACCCTTCATGATGGACGC
ACTGATCAAGAAATTAAAATCCTGGAAGAAAACAAGGAATTGGAAAATGCTTTGAAAAAT
ATCCAGCTGCCTAAAGAGGAAATTAAGAAACTTGAAGTAGATGAAATTACTTTATGGTAC
AAGATGATTCTTCCTCCTCAATTTGACAGATCAAAGAAGTATCCCTTGCTAATTCAAGTG
TATGGTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTAT
CTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAA
GGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAG
ATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATA
TGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTT
TTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTAC
ACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCA
ACTGTGATGGCAAGAGCAGAATATTTCAGAAATGTAGACTATCTTCTCATCCACGGAACA
GCAGATGATAATGTGCACTTTCAAAACTCAGCACAGATTGCTAAAGCTCTGGTTAATGCA
CAAGTGGATTTCCAGGCAATGTGGTACTCTGACCAGAACCACGGCTTATCCGGCCTGTCC
ACGAACCACTTATACACCCACATGACCCACTTCCTAAAGCAGTGTTTCTCTTTGTCAGAC
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2324
Start on reference sequence 42
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FAP
Symbol Nomenclature : FAP
SYNONYM : DPPIV; FAPA
Designation : 170 kDa melanoma membrane-bound gelatinase|integral membrane serine protease|seprase
Full Nomenclature : fibroblast activation protein, alpha
GENEID : 2191
HGNC : 3590
MIM : 600403
Vega : OTTHUMG00000153890
Target GenBank: BC026250

 

Reference Sequence Alignment

  

HsCD00043440      ATGAAGACTTGGGTAAAAATCGTATTTGGAGTTGCCACCTCTGCTGTGCTTGCCTTATTG
NM_004460.2       ATGAAGACTTGGGTAAAAATCGTATTTGGAGTTGCCACCTCTGCTGTGCTTGCCTTATTG
                  ************************************************************

HsCD00043440      GTGATGTGCATTGTCTTACGCCCTTCAAGAGTTCATAACTCTGAAGAAAATACAATGAGA
NM_004460.2       GTGATGTGCATTGTCTTACGCCCTTCAAGAGTTCATAACTCTGAAGAAAATACAATGAGA
                  ************************************************************

HsCD00043440      GCACTCACACTGAAGGATATTTTAAATGGAACATTTTCTTATAAAACATTTTTTCCAAAC
NM_004460.2       GCACTCACACTGAAGGATATTTTAAATGGAACATTTTCTTATAAAACATTTTTTCCAAAC
                  ************************************************************

HsCD00043440      TGGATTTCAGGACAAGAATATCTTCATCAATCTGCAGATAACAATATAGTACTTTATAAT
NM_004460.2       TGGATTTCAGGACAAGAATATCTTCATCAATCTGCAGATAACAATATAGTACTTTATAAT
                  ************************************************************

HsCD00043440      ATTGAAACAGGACAATCATATACCATTTTGAGTAATAGAACCATGAAAAGTGTGAATGCT
NM_004460.2       ATTGAAACAGGACAATCATATACCATTTTGAGTAATAGAACCATGAAAAGTGTGAATGCT
                  ************************************************************

HsCD00043440      TCAAATTACGGCTTATCACCTGATCGGCAATTTGTATATCTAGAAAGTGATTATTCAAAG
NM_004460.2       TCAAATTACGGCTTATCACCTGATCGGCAATTTGTATATCTAGAAAGTGATTATTCAAAG
                  ************************************************************

HsCD00043440      CTTTGGAGATACTCTTACACAGCAACATATTACATCTATGACCTTAGCAATGGAGAATTT
NM_004460.2       CTTTGGAGATACTCTTACACAGCAACATATTACATCTATGACCTTAGCAATGGAGAATTT
                  ************************************************************

HsCD00043440      GTAAGAGGAAATGAGCTTCCTCGTCCAATTCAGTATTTATGCTGGTCGCCTGTTGGGAGT
NM_004460.2       GTAAGAGGAAATGAGCTTCCTCGTCCAATTCAGTATTTATGCTGGTCGCCTGTTGGGAGT
                  ************************************************************

HsCD00043440      AAATTAGCATATGTCTATCAAAACAATATCTATTTGAAACAAAGACCAGGAGATCCACCT
NM_004460.2       AAATTAGCATATGTCTATCAAAACAATATCTATTTGAAACAAAGACCAGGAGATCCACCT
                  ************************************************************

HsCD00043440      TTTCAAATAACATTTAATGGAAGAGAAAATAAAATATTTAATGGAATCCCAGACTGGGTT
NM_004460.2       TTTCAAATAACATTTAATGGAAGAGAAAATAAAATATTTAATGGAATCCCAGACTGGGTT
                  ************************************************************

HsCD00043440      TATGAAGAGGAAATGCTTGCTACAAAATATGCTCTCTGGTGGTCTCCTAATGGAAAATTT
NM_004460.2       TATGAAGAGGAAATGCTTGCTACAAAATATGCTCTCTGGTGGTCTCCTAATGGAAAATTT
                  ************************************************************

HsCD00043440      TTGGCATATGCGGAATTTAATGATACGGATATACCAGTTATTGCCTATTCCTATTATGGC
NM_004460.2       TTGGCATATGCGGAATTTAATGATACGGATATACCAGTTATTGCCTATTCCTATTATGGC
                  ************************************************************

HsCD00043440      GATGAACAATATCCTAGAACAATAAATATTCCATACCCAAAGGCTGGAGCTAAGAATCCC
NM_004460.2       GATGAACAATATCCTAGAACAATAAATATTCCATACCCAAAGGCTGGAGCTAAGAATCCC
                  ************************************************************

HsCD00043440      GTTGTTCGGATATTTATTATCGATACCACTTACCCTGCGTATGTAGGTCCCCAGGAAGTG
NM_004460.2       GTTGTTCGGATATTTATTATCGATACCACTTACCCTGCGTATGTAGGTCCCCAGGAAGTG
                  ************************************************************

HsCD00043440      CCTGTTCCAGCAATGATAGCCTCAAGTGATTATTATTTCAGTTGGCTCACGTGGGTTACT
NM_004460.2       CCTGTTCCAGCAATGATAGCCTCAAGTGATTATTATTTCAGTTGGCTCACGTGGGTTACT
                  ************************************************************

HsCD00043440      GATGAACGAGTATGTTTGCAGTGGCTAAAAAGAGTCCAGAATGTTTCGGTCCTGTCTATA
NM_004460.2       GATGAACGAGTATGTTTGCAGTGGCTAAAAAGAGTCCAGAATGTTTCGGTCCTGTCTATA
                  ************************************************************

HsCD00043440      TGTGACTTCAGGGAAGACTGGCAGACATGGGATTGTCCAAAGACCCAGGAGCATATAGAA
NM_004460.2       TGTGACTTCAGGGAAGACTGGCAGACATGGGATTGTCCAAAGACCCAGGAGCATATAGAA
                  ************************************************************

HsCD00043440      GAAAGCAGAACTGGATGGGCTGGTGGATTCTTTGTTTCAACACCAGTTTTCAGCTATGAT
NM_004460.2       GAAAGCAGAACTGGATGGGCTGGTGGATTCTTTGTTTCAACACCAGTTTTCAGCTATGAT
                  ************************************************************

HsCD00043440      GCCATTTCGTACTACAAAATATTTAGTGACAAGGATGGCTACAAACATATTCACTATATC
NM_004460.2       GCCATTTCGTACTACAAAATATTTAGTGACAAGGATGGCTACAAACATATTCACTATATC
                  ************************************************************

HsCD00043440      AAAGACACTGTGGAAAATGCTATTCAAATTACAAGTGGCAAGTGGGAGGCCATAAATATA
NM_004460.2       AAAGACACTGTGGAAAATGCTATTCAAATTACAAGTGGCAAGTGGGAGGCCATAAATATA
                  ************************************************************

HsCD00043440      TTCAGAGTAACACAGGATTCACTGTTTTATTCTAGCAATGAATTTGAAGAATACCCTGGA
NM_004460.2       TTCAGAGTAACACAGGATTCACTGTTTTATTCTAGCAATGAATTTGAAGAATACCCTGGA
                  ************************************************************

HsCD00043440      AGAAGAAACATCTACAGAATTAGCATTGGAAGCTATCCTCCAAGCAAGAAGTGTGTTACT
NM_004460.2       AGAAGAAACATCTACAGAATTAGCATTGGAAGCTATCCTCCAAGCAAGAAGTGTGTTACT
                  ************************************************************

HsCD00043440      TGCCATCTAAGGAAAGAAAGGTGCCAATATTACACAGCAAGTTTCAGCGACTACGCCAAG
NM_004460.2       TGCCATCTAAGGAAAGAAAGGTGCCAATATTACACAGCAAGTTTCAGCGACTACGCCAAG
                  ************************************************************

HsCD00043440      TACTATGCACTTGTCTGCTACGGCCCAGGCATCCCCATTTCCACCCTTCATGATGGACGC
NM_004460.2       TACTATGCACTTGTCTGCTACGGCCCAGGCATCCCCATTTCCACCCTTCATGATGGACGC
                  ************************************************************

HsCD00043440      ACTGATCAAGAAATTAAAATCCTGGAAGAAAACAAGGAATTGGAAAATGCTTTGAAAAAT
NM_004460.2       ACTGATCAAGAAATTAAAATCCTGGAAGAAAACAAGGAATTGGAAAATGCTTTGAAAAAT
                  ************************************************************

HsCD00043440      ATCCAGCTGCCTAAAGAGGAAATTAAGAAACTTGAAGTAGATGAAATTACTTTATGGTAC
NM_004460.2       ATCCAGCTGCCTAAAGAGGAAATTAAGAAACTTGAAGTAGATGAAATTACTTTATGGTAC
                  ************************************************************

HsCD00043440      AAGATGATTCTTCCTCCTCAATTTGACAGATCAAAGAAGTATCCCTTGCTAATTCAAGTG
NM_004460.2       AAGATGATTCTTCCTCCTCAATTTGACAGATCAAAGAAGTATCCCTTGCTAATTCAAGTG
                  ************************************************************

HsCD00043440      TATGGTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTAT
NM_004460.2       TATGGTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTAT
                  ************************************************************

HsCD00043440      CTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAA
NM_004460.2       CTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAA
                  ************************************************************

HsCD00043440      GGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAG
NM_004460.2       GGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAG
                  ************************************************************

HsCD00043440      ATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATA
NM_004460.2       ATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATA
                  ************************************************************

HsCD00043440      TGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTT
NM_004460.2       TGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTT
                  ************************************************************

HsCD00043440      TTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTAC
NM_004460.2       TTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTAC
                  ************************************************************

HsCD00043440      ACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCA
NM_004460.2       ACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCA
                  ************************************************************

HsCD00043440      ACTGTGATGGCAAGAGCAGAATATTTCAGAAATGTAGACTATCTTCTCATCCACGGAACA
NM_004460.2       ACTGTGATGGCAAGAGCAGAATATTTCAGAAATGTAGACTATCTTCTCATCCACGGAACA
                  ************************************************************

HsCD00043440      GCAGATGATAATGTGCACTTTCAAAACTCAGCACAGATTGCTAAAGCTCTGGTTAATGCA
NM_004460.2       GCAGATGATAATGTGCACTTTCAAAACTCAGCACAGATTGCTAAAGCTCTGGTTAATGCA
                  ************************************************************

HsCD00043440      CAAGTGGATTTCCAGGCAATGTGGTACTCTGACCAGAACCACGGCTTATCCGGCCTGTCC
NM_004460.2       CAAGTGGATTTCCAGGCAATGTGGTACTCTGACCAGAACCACGGCTTATCCGGCCTGTCC
                  ************************************************************

HsCD00043440      ACGAACCACTTATACACCCACATGACCCACTTCCTAAAGCAGTGTTTCTCTTTGTCAGAC
NM_004460.2       ACGAACCACTTATACACCCACATGACCCACTTCCTAAAGCAGTGTTTCTCTTTGTCAGAC
                  ************************************************************

HsCD00043440      TAG
NM_004460.2       TAA
                  **.

Pathways

NCI : Canonical Wnt signaling pathway
NCI : CDC42 signaling events
NCI : Degradation of beta catenin
NCI : Direct p53 effectors
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of CDC42 activity
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
Panther : Angiogenesis
Panther : Wnt signaling pathway
Reactome : Apoptosis
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Beta-catenin phosphorylation cascade
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
WikiPathway : angiogenesis overview
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Irinotecan Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

UniProt : Q4LE70
UniProt : B7Z2B6
UniProt : P25054
HPRD : 02674

Clone

Cloning Information : 176795
HIP Master Clone ID : 151940
Original Clone ID : FLH176795.01X

Organism


TAX_ID : 9606
Species Specific ID: 324

Genome

Chromosome : 2
Map Location : 2q23
Ensembl : ENSG00000078098

Reagents

Labome : FAP-antibody