DNASU Plasmid Repository • 480.965.5697 | Email

FGF1 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FGF1
Gene Name:  fibroblast growth factor 1 (acidic)
Sequence             
Original Clone ID: ccsbBroad304_00555
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00434678

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 466nts         Open reading frame : 1 to 466
Reference Sequence Alignment

ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGAT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FGF1
Symbol Nomenclature : FGF1
SYNONYM : AFGF; ECGF; ECGF-beta; ECGFA; ECGFB; FGF-1; FGF-alpha; FGFA; GLIO703; HBGF-1; HBGF1
Designation : beta-endothelial cell growth factor|endothelial cell growth factor, alpha|endothelial cell growth factor, beta|fibroblast growth factor 1|heparin-binding growth factor 1
Full Nomenclature : fibroblast growth factor 1 (acidic)
GENEID : 2246
HGNC : 3665
MIM : 131220
Vega : OTTHUMG00000059703
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00434678        ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257209.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257206.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001144892.2      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001144935.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257211.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257205.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257212.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001144934.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257208.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257210.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_001257207.1      ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
NM_000800.4         ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA
                    ************************************************************

HsCD00434678        GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257209.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257206.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001144892.2      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001144935.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257211.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257205.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257212.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001144934.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257208.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257210.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_001257207.1      GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
NM_000800.4         GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC
                    ************************************************************

HsCD00434678        CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257209.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257206.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001144892.2      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001144935.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257211.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257205.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257212.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001144934.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257208.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257210.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_001257207.1      CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
NM_000800.4         CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAG
                    ************************************************************

HsCD00434678        CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257209.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257206.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001144892.2      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001144935.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257211.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257205.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257212.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001144934.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257208.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257210.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_001257207.1      CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
NM_000800.4         CTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTG
                    ************************************************************

HsCD00434678        GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257209.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257206.1      GCCATGGACACCGACGGGCTTTTATACG---GCTCAACACCAAATGAGGAATGTTTGTTC
NM_001144892.2      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001144935.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257211.1      GCCATGGACACCGACGGGCTTTTATACG---GCTCAACACCAAATGAGGAATGTTTGTTC
NM_001257205.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257212.1      GCCATGGACACCGACGGGCTTTTATACG---GCTCAACACCAAATGAGGAATGTTTGTTC
NM_001144934.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257208.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257210.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_001257207.1      GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
NM_000800.4         GCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTC
                    ****************************    . ..************************

HsCD00434678        CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257209.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257206.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001144892.2      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001144935.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257211.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257205.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257212.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001144934.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257208.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257210.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_001257207.1      CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
NM_000800.4         CTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAG
                    ************************************************************

HsCD00434678        AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257209.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257206.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001144892.2      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001144935.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257211.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257205.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257212.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001144934.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257208.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257210.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_001257207.1      AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
NM_000800.4         AATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTAT
                    ************************************************************

HsCD00434678        GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGAT---
NM_001257209.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257206.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001144892.2      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001144935.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257211.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257205.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257212.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001144934.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257208.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257210.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_001257207.1      GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
NM_000800.4         GGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA
                    *********************************************   

Pathways

NCI : FGF signaling pathway
Panther : Angiogenesis
Panther : FGF signaling pathway
Reactome : Activated point mutants of FGFR2
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FGFR ligand binding and activation
Reactome : FGFR1 ligand binding and activation
Reactome : FGFR1b ligand binding and activation
Reactome : FGFR1c ligand binding and activation
Reactome : FGFR2 ligand binding and activation
Reactome : FGFR2b ligand binding and activation
Reactome : FGFR2c ligand binding and activation
Reactome : FGFR3 ligand binding and activation
Reactome : FGFR3b ligand binding and activation
Reactome : FGFR3c ligand binding and activation
Reactome : FGFR4 ligand binding and activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by FGFR2 mutants
Reactome : Signaling by FGFR3 mutants
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by activated point mutants of FGFR1
Reactome : Signaling by activated point mutants of FGFR3
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : angiogenesis overview

Clone

Original Clone ID : ccsbBroad304_00555

Organism


TAX_ID : 9606
Species Specific ID: 2246

Genome

Chromosome : 5
Map Location : 5q31
Ensembl : ENSG00000113578

Reagents

Labome : FGF1-antibody