DNASU Plasmid Repository • 480.965.5697 | Email

BID (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BID
Gene Name:  BH3 interacting domain death agonist
Sequence             
Original Clone ID: ccsbBroad304_00161
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Harvard Medical School
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
The ORFeome Collaboration
HsCD00441001

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 586nts        
Open reading frame : 1 to 586
Reference Sequence Alignment

ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAGTGCATCACAAACCTACTG
GTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGCAGAGAGCTGGACGCACTG
GGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTACGATGAGCTGCAGACTGAT
GGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCAGATTCTGAAAGTCAAGAA
GACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGGGACAGCATGGACCGTAGC
ATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACCAGCCGGTCGGAG
GAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAGGCCTACCCTAGA
GACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCC
AGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACAGTGAATTTTATTAACCAG
AACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATGGAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
1 error
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  CMV forward
Reverse:  None
Description: with tag/fusion/marker assay, Gateway®, acceptor (destination), recombinational cloning clone, lentiviral infection expression with BlastR and T7 and attR1 and CMV and cPPT and V5 and AmpR and attR2 and CAT and ccdB and WPRE; ampicillin resistance in bacterial, blasticidin resistance in mammalian;
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: EvNO00877063
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter CMV CMV promoter 14 566
promoter T7 T7 promoter 3690 3672
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker BlastR Blasticidin resistance gene 8753 9148
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BID
Symbol Nomenclature : BID
SYNONYM : FP497
Designation : BH3-interacting domain death agonist|BID isoform ES(1b)|BID isoform L(2)|BID isoform Si6|Human BID coding sequence|apoptic death agonist|desmocollin type 4|p22 BID
Full Nomenclature : BH3 interacting domain death agonist
GENEID : 637
GenBank Accession : EU446512
HGNC : 1050
MIM : 601997
Vega : OTTHUMG00000150087
Target GenBank: EU446512

 

Reference Sequence Alignment

  

HsCD00441001        ------------------------------------------------------------
NM_001244567.1      ------------------------------------------------------------
NM_001196.3         ------------------------------------------------------------
NM_197966.2         ATGTGCAGCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGGGCCGGGCCGGCTGG
                                                                                

HsCD00441001        ------------------------------------------------------------
NM_001244567.1      ------------------------------------------------------------
NM_001196.3         ------------------------------------------------------------
NM_197966.2         AGGAGCACAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAGGAGTGAGTCGGAGC
                                                                                

HsCD00441001        ------------------ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_001244567.1      ------------------ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_001196.3         ------------------ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_197966.2         TGCCGCGCTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
                                      ******************************************

HsCD00441001        TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_001244567.1      TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_001196.3         TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_197966.2         TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
                    ************************************************************

HsCD00441001        AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_001244567.1      AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_001196.3         AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_197966.2         AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
                    ************************************************************

HsCD00441001        GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_001244567.1      GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_001196.3         GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_197966.2         GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
                    ************************************************************

HsCD00441001        GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_001244567.1      GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_001196.3         GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_197966.2         GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
                    ************************************************************

HsCD00441001        GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_001244567.1      GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_001196.3         GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_197966.2         GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
                    ************************************************************

HsCD00441001        AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_001244567.1      AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_001196.3         AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_197966.2         AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
                    ************************************************************

HsCD00441001        CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_001244567.1      CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_001196.3         CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_197966.2         CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
                    ************************************************************

HsCD00441001        CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_001244567.1      CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_001196.3         CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_197966.2         CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
                    ************************************************************

HsCD00441001        GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_001244567.1      GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_001196.3         GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_197966.2         GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
                    ************************************************************

HsCD00441001        GAC---
NM_001244567.1      GACTGA
NM_001196.3         GACTGA
NM_197966.2         GACTGA
                    ***   

Pathways

NCI : ATM pathway
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : Direct p53 effectors
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
Reactome : Activation and oligomerization of BAK protein
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Activation, myristolyation of BID and translocation to mitochondria
Reactome : Activation, translocation and oligomerization of BAX
Reactome : Apoptosis
Reactome : BH3-only proteins associate with and inactivate anti-apoptotic BCL-2 members
Reactome : Intrinsic Pathway for Apoptosis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TP53 network

Protein

HPRD : 03590

Clone

Original Clone ID : ccsbBroad304_00161

Organism


TAX_ID : 9606
Species Specific ID: 637

Genome

Chromosome : 22
Map Location : 22q11.1
Ensembl : ENSG00000015475

Reagents

Labome : Bid-antibody