DNASU Plasmid Repository • 480.965.5697 | Email

MYD88 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MYD88
Gene Name:  myeloid differentiation primary response 88
Sequence             
Original Clone ID: ccsbBroad304_10981
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00441165

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 889nts         Open reading frame : 1 to 889
Reference Sequence Alignment

ATGGCTGCAGGAGGTCCCGGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTT
CCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGG
ACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAG
ATCCGGCAACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGA
CGCCCTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGAC
GTGCTGCTGGAGCTGGGACCCAGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAG
CAGCAGGAGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGG
ACAGCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGT
TTCGATGCCTTCATCTGCTATTGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGG
CAACTGGAACAGACAAACTATCGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCT
GGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGAAAAGAGGTGCCGCCGGATGGTG
GTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCA
CTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATG
AAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGC
ACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MYD88
Symbol Nomenclature : MYD88
SYNONYM : MYD88D
Designation : myeloid differentiation primary response gene (88)|myeloid differentiation primary response protein MyD88
Full Nomenclature : myeloid differentiation primary response 88
GENEID : 4615
GenBank Accession : EU832045
HGNC : 7562
MIM : 602170
Vega : OTTHUMG00000131083
Target GenBank: EU832045

 

Reference Sequence Alignment

  

HsCD00441165        ---------------------------------------ATGGCTGCAGGAGGTCCCGGC
NM_001172567.1      ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC
NM_002468.4         ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGC
                                                           *********************

HsCD00441165        GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
NM_001172567.1      GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
NM_002468.4         GCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATG
                    ************************************************************

HsCD00441165        CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
NM_001172567.1      CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
NM_002468.4         CGAGTGCGGCGCCGCCTGTCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGG
                    ************************************************************

HsCD00441165        ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
NM_001172567.1      ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
NM_002468.4         ACCGCGCTGGCGGAGGAGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAA
                    ************************************************************

HsCD00441165        GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
NM_001172567.1      GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
NM_002468.4         GCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGC
                    ************************************************************

HsCD00441165        CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
NM_001172567.1      CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
NM_002468.4         CGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCC
                    ************************************************************

HsCD00441165        AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
NM_001172567.1      AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
NM_002468.4         AGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCTGAGAAG
                    ************************************************************

HsCD00441165        CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
NM_001172567.1      CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
NM_002468.4         CCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATC
                    ************************************************************

HsCD00441165        ACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTAT
NM_001172567.1      ACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTAT
NM_002468.4         ACCACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTAT
                    ************************************************************

HsCD00441165        TGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT
NM_001172567.1      TGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT
NM_002468.4         TGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTAT
                    ************************************************************

HsCD00441165        CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATT
NM_001172567.1      CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATT
NM_002468.4         CGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATT
                    ************************************************************

HsCD00441165        GCTAGTGAGCTCATCGAAAAGAG------------------------GTGCCGCCGGATG
NM_001172567.1      GCTAGTGAGCTCATCGAAAAGAGGTTGGCTAGAAGGCCACGGGGTGGGTGCCGCCGGATG
NM_002468.4         GCTAGTGAGCTCATCGAAAAGAG------------------------GTGCCGCCGGATG
                    ***********************                        *************

HsCD00441165        GTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTT
NM_001172567.1      GTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTT
NM_002468.4         GTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTT
                    ************************************************************

HsCD00441165        GCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCA
NM_001172567.1      GCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCA
NM_002468.4         GCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCA
                    ************************************************************

HsCD00441165        ATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
NM_001172567.1      ATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
NM_002468.4         ATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
                    ************************************************************

HsCD00441165        TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCC---
NM_001172567.1      TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGA
NM_002468.4         TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGA
                    ***************************************************   

Pathways

NCI : Endogenous TLR signaling
NCI : IL1-mediated signaling events
NCI : p75(NTR)-mediated signaling
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DEx/H-box helicases activate type I IFN and inflammatory cytokines production
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signalling by NGF
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : IL-1 signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Original Clone ID : ccsbBroad304_10981

Organism


TAX_ID : 9606
Species Specific ID: 4615

Genome

Chromosome : 3
Map Location : 3p22
Ensembl : ENSG00000172936

Reagents

Labome : MYD88-antibody