DNASU Plasmid Repository • 480.965.5697 | Email

STUB1 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  STUB1
Gene Name:  STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Sequence             
Original Clone ID: ccsbBroad304_02378
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00444821

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 910nts         Open reading frame : 1 to 910
Reference Sequence Alignment

ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC
GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA
AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCC
GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG
GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG
GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT
TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA
ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG
CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC
CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT
GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG
AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG
CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC
CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC
ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG
GAGGACTAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : STUB1
Symbol Nomenclature : STUB1
SYNONYM : CHIP; HSPABP2; NY-CO-7; SDCCAG7; UBOX1
Designation : CLL-associated antigen KW-8|E3 ubiquitin-protein ligase CHIP|STIP1 homology and U box-containing protein 1|antigen NY-CO-7|carboxy terminus of Hsp70-interacting protein|heat shock protein A binding protein 2 (c-terminal)|serologically defined colon cancer antigen 7
Full Nomenclature : STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
GENEID : 10273
Locus Tag : LA16c-313D11.6
GenBank Accession : DQ896502
HGNC : 11427
MIM : 607207
Vega : OTTHUMG00000121140
Target GenBank: DQ896502

 

Reference Sequence Alignment

  

HsCD00444821      ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC
NM_005861.2       ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC
                  ************************************************************

HsCD00444821      GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA
NM_005861.2       GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA
                  ************************************************************

HsCD00444821      AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCC
NM_005861.2       AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCC
                  ************************************************************

HsCD00444821      GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG
NM_005861.2       GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG
                  ************************************************************

HsCD00444821      GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG
NM_005861.2       GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG
                  ************************************************************

HsCD00444821      GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT
NM_005861.2       GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT
                  ************************************************************

HsCD00444821      TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA
NM_005861.2       TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA
                  ************************************************************

HsCD00444821      ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG
NM_005861.2       ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG
                  ************************************************************

HsCD00444821      CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC
NM_005861.2       CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC
                  ************************************************************

HsCD00444821      CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT
NM_005861.2       CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT
                  ************************************************************

HsCD00444821      GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG
NM_005861.2       GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG
                  ************************************************************

HsCD00444821      AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG
NM_005861.2       AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG
                  ************************************************************

HsCD00444821      CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC
NM_005861.2       CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC
                  ************************************************************

HsCD00444821      CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC
NM_005861.2       CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC
                  ************************************************************

HsCD00444821      ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG
NM_005861.2       ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG
                  ************************************************************

HsCD00444821      GAGGACTAC---
NM_005861.2       GAGGACTACTGA
                  *********   

Pathways

NCI : Alpha-synuclein signaling
Panther : Parkinson disease
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Immune System
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by ERBB2
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
WikiPathway : Androgen receptor signaling pathway

Protein

SMART domain : TPR : Tetratricopeptide repeats
SMART domain : Ubox : Modified RING finger domain
HPRD : 06232

Clone

Original Clone ID : ccsbBroad304_02378

Organism


TAX_ID : 9606
Species Specific ID: 10273

Genome

Chromosome : 16
Map Location : 16p13.3
Ensembl : ENSG00000103266

Reagents

Labome : CHIP-antibody