DNASU Plasmid Repository • 480.965.5697 | Email

HSPB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HSPB1
Gene Name:  heat shock 27kDa protein 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH009565.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000450

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 618nts         Open reading frame : 1 to 618
Reference Sequence Alignment

ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGC
GACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAG
GAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC
GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAA
CTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGAT
GTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC
ACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGG
AAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAG
GGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC
ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGAT
GAGACTGCCGCCAAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 725
Start on reference sequence 108
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HSPB1
Symbol Nomenclature : HSPB1
SYNONYM : CMT2F; HEL-S-102; HMN2B; HS.76067; HSP27; HSP28; Hsp25; SRP27
Designation : 28 kDa heat shock protein|HSP 27|epididymis secretory protein Li 102|estrogen-regulated 24 kDa protein|heat shock 27 kDa protein|heat shock 27kD protein 1|heat shock protein beta-1|stress-responsive protein 27
Full Nomenclature : heat shock 27kDa protein 1
GENEID : 3315
GI : 61365789
GenBank Accession : AY890826
HGNC : 5246
MIM : 602195
Vega : OTTHUMG00000023228
Target GenBank: NM_001540

 

Reference Sequence Alignment

  

HsCD00000450      ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGC
NM_001540.3       ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGC
                  ************************************************************

HsCD00000450      GACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAG
NM_001540.3       GACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAG
                  ************************************************************

HsCD00000450      GAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC
NM_001540.3       GAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC
                  ************************************************************

HsCD00000450      GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAA
NM_001540.3       GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAA
                  ************************************************************

HsCD00000450      CTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGAT
NM_001540.3       CTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGAT
                  ************************************************************

HsCD00000450      GTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC
NM_001540.3       GTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC
                  ************************************************************

HsCD00000450      ACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGG
NM_001540.3       ACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGG
                  ************************************************************

HsCD00000450      AAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAG
NM_001540.3       AAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAG
                  ************************************************************

HsCD00000450      GGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC
NM_001540.3       GGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC
                  ************************************************************

HsCD00000450      ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGAT
NM_001540.3       ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGAT
                  ************************************************************

HsCD00000450      GAGACTGCCGCCAAGTTG
NM_001540.3       GAGACTGCCGCCAAGTAA
                  ****************:.

Pathways

NCI : Signaling mediated by p38-alpha and p38-beta
NCI : p38 signaling mediated by MAPKAP kinases
Panther : Angiogenesis
Panther : VEGF signaling pathway
Panther : p38 MAPK pathway
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Gene Expression
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : MAPK signaling pathway
WikiPathway : p38 MAPK Signaling Pathway

Protein

UniProt : P04792
HPRD : 09076

Clone

Cloning Information : 9565
HIP Master Clone ID : 13474
Original Clone ID : FLH009565.01L

Organism


TAX_ID : 9606
Species Specific ID: 3315

Genome

Chromosome : 7
Map Location : 7q11.23
Ensembl : ENSG00000106211

Reagents

Labome : HSP27-antibody