DNASU Plasmid Repository • 480.965.5697 | Email

PPP2R1A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPP2R1A
Gene Name:  protein phosphatase 2, regulatory subunit A, alpha
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH024688.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004531

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1770nts         Open reading frame : 1 to 1770
Reference Sequence Alignment

ATGGCGGCGGCCGACGGCGACGACTCGCTGTACCCCATCGCGGTGCTCATAGACGAACTC
CGCAATGAGGACGTTCAGCTTCGCCTCAACAGCATCAAGAAGCTGTCCACCATCGCCTTG
GCCCTTGGGGTTGAAAGGACCCGAAGTGAGCTTCTGCCTTTCCTTACAGATACCATCTAT
GATGAAGATGAGGTCCTCCTGGCCCTGGCAGAACAGCTGGGAACCTTCACTACCCTGGTG
GGAGGCCCAGAGTACGTGCACTGCCTGCTGCCACCGCTGGAGTCGCTGGCCACAGTGGAG
GAGACAGTGGTGCGGGACAAGGCAGTGGAGTCCTTACGGGCCATCTCACACGAGCACTCG
CCCTCTGACCTGGAGGCGCACTTTGTGCCGCTAGTGAAGCGGCTGGCGGGCGGCGACTGG
TTCACCTCCCGCACCTCGGCCTGCGGCCTCTTCTCCGTCTGCTACCCCCGAGTGTCCAGT
GCTGTGAAGGCGGAACTTCGACAGTACTTCCGGAACCTGTGCTCAGATGACACCCCCATG
GTGCGGCGGGCCGCAGCCTCCAAGCTGGGGGAGTTTGCCAAGGTGCTGGAGCTGGACAAC
GTCAAGAGTGAGATCATCCCCATGTTCTCCAACCTGGCCTCTGACGAGCAGGACTCGGTG
CGGCTGCTGGCGGTGGAGGCGTGCGTGAACATCGCCCAGCTTCTGCCCCAGGAGGATCTG
GAGGCCCTGGTGATGCCCACTCTGCGCCAGGCCGCTGAAGACAAGTCCTGGCGCGTCCGC
TACATGGTGGCTGACAAGTTCACAGAGCTCCAGAAAGCAGTGGGGCCTGAGATCACCAAG
ACAGACCTGGTCCCTGCCTTCCAGAACCTGATGAAAGACTGTGAGGCCGAGGTGAGGGCC
GCAGCCTCCCACAAGGTCAAAGAGTTCTGTGAAAACCTCTCAGCTGACTGTCGGGAGAAT
GTGATCATGTCCCAGATCTTGCCCTGCATCAAGGAGCTGGTGTCCGATGCCAACCAACAT
GTCAAGTCTGCCCTGGCCTCAGTCATCATGGGTCTCTCTCCCATCTTGGGCAAAGACAAC
ACCATCGAGCACCTCTTGCCCCTCTTCCTGGCTCAGCTGAAGGATGAGTGCCCTGAGGTA
CGGCTGAACATCATCTCTAACCTGGACTGTGTGAACGAGGTGATTGGCATCCGGCAGCTG
TCCCAGTCCCTGCTCCCTGCCATTGTGGAGCTGGCTGAGGACGCCAAGTGGCGGGTGCGG
CTGGCCATCATTGAGTACATGCCCCTCCTGGCTGGACAGCTGGGAGTGGAGTTCTTTGAT
GAGAAACTTAACTCCTTGTGCATGGCCTGGCTTGTGGATCATGTATATGCCATCCGCGAG
GCAGCCACCAGCAACCTGAAGAAGCTAGTGGAAAAGTTTGGGAAGGAGTGGGCCCATGCC
ACAATCATCCCCAAGGTCTTGGCCATGTCCGGAGACCCCAACTACCTGCACCGCATGACT
ACGCTCTTCTGCATCAATGTGCTGTCTGAGGTCTGTGGGCAGGACATCACCACCAAGCAC
ATGCTACCCACGGTTCTGCGCATGGCTGGGGACCCGGTTGCCAATGTCCGCTTCAATGTG
GCCAAGTCTCTGCAGAAGATAGGGCCCATCCTGGACAACAGCACCTTGCAGAGTGAAGTC
AAGCCCATCCTAGAGAAGCTGACCCAGGACCAGGATGTGGACGTCAAATACTTTGCCCAG
GAGGCTCTGACTGTTCTGTCTCTCGCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1820
Start on reference sequence 51
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPP2R1A
Symbol Nomenclature : PPP2R1A
SYNONYM : PP2A-Aalpha; PP2AAALPHA; PR65A
Designation : PP2A subunit A isoform PR65-alpha|PP2A subunit A isoform R1-alpha|medium tumor antigen-associated 61 KDA protein|protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform|serine/threonine protein phosphatase 2A, 65 kDa regulatory subunit A, alpha isoform|serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform
Full Nomenclature : protein phosphatase 2, regulatory subunit A, alpha
GENEID : 5518
GI : 60653812
GenBank Accession : AY892682
HGNC : 9302
MIM : 605983
Target GenBank: BC001537

 

Reference Sequence Alignment

  

HsCD00004531      ATGGCGGCGGCCGACGGCGACGACTCGCTGTACCCCATCGCGGTGCTCATAGACGAACTC
NM_014225.5       ATGGCGGCGGCCGACGGCGACGACTCGCTGTACCCCATCGCGGTGCTCATAGACGAACTC
                  ************************************************************

HsCD00004531      CGCAATGAGGACGTTCAGCTTCGCCTCAACAGCATCAAGAAGCTGTCCACCATCGCCTTG
NM_014225.5       CGCAATGAGGACGTTCAGCTTCGCCTCAACAGCATCAAGAAGCTGTCCACCATCGCCTTG
                  ************************************************************

HsCD00004531      GCCCTTGGGGTTGAAAGGACCCGAAGTGAGCTTCTGCCTTTCCTTACAGATACCATCTAT
NM_014225.5       GCCCTTGGGGTTGAAAGGACCCGAAGTGAGCTTCTGCCTTTCCTTACAGATACCATCTAT
                  ************************************************************

HsCD00004531      GATGAAGATGAGGTCCTCCTGGCCCTGGCAGAACAGCTGGGAACCTTCACTACCCTGGTG
NM_014225.5       GATGAAGATGAGGTCCTCCTGGCCCTGGCAGAACAGCTGGGAACCTTCACTACCCTGGTG
                  ************************************************************

HsCD00004531      GGAGGCCCAGAGTACGTGCACTGCCTGCTGCCACCGCTGGAGTCGCTGGCCACAGTGGAG
NM_014225.5       GGAGGCCCAGAGTACGTGCACTGCCTGCTGCCACCGCTGGAGTCGCTGGCCACAGTGGAG
                  ************************************************************

HsCD00004531      GAGACAGTGGTGCGGGACAAGGCAGTGGAGTCCTTACGGGCCATCTCACACGAGCACTCG
NM_014225.5       GAGACAGTGGTGCGGGACAAGGCAGTGGAGTCCTTACGGGCCATCTCACACGAGCACTCG
                  ************************************************************

HsCD00004531      CCCTCTGACCTGGAGGCGCACTTTGTGCCGCTAGTGAAGCGGCTGGCGGGCGGCGACTGG
NM_014225.5       CCCTCTGACCTGGAGGCGCACTTTGTGCCGCTAGTGAAGCGGCTGGCGGGCGGCGACTGG
                  ************************************************************

HsCD00004531      TTCACCTCCCGCACCTCGGCCTGCGGCCTCTTCTCCGTCTGCTACCCCCGAGTGTCCAGT
NM_014225.5       TTCACCTCCCGCACCTCGGCCTGCGGCCTCTTCTCCGTCTGCTACCCCCGAGTGTCCAGT
                  ************************************************************

HsCD00004531      GCTGTGAAGGCGGAACTTCGACAGTACTTCCGGAACCTGTGCTCAGATGACACCCCCATG
NM_014225.5       GCTGTGAAGGCGGAACTTCGACAGTACTTCCGGAACCTGTGCTCAGATGACACCCCCATG
                  ************************************************************

HsCD00004531      GTGCGGCGGGCCGCAGCCTCCAAGCTGGGGGAGTTTGCCAAGGTGCTGGAGCTGGACAAC
NM_014225.5       GTGCGGCGGGCCGCAGCCTCCAAGCTGGGGGAGTTTGCCAAGGTGCTGGAGCTGGACAAC
                  ************************************************************

HsCD00004531      GTCAAGAGTGAGATCATCCCCATGTTCTCCAACCTGGCCTCTGACGAGCAGGACTCGGTG
NM_014225.5       GTCAAGAGTGAGATCATCCCCATGTTCTCCAACCTGGCCTCTGACGAGCAGGACTCGGTG
                  ************************************************************

HsCD00004531      CGGCTGCTGGCGGTGGAGGCGTGCGTGAACATCGCCCAGCTTCTGCCCCAGGAGGATCTG
NM_014225.5       CGGCTGCTGGCGGTGGAGGCGTGCGTGAACATCGCCCAGCTTCTGCCCCAGGAGGATCTG
                  ************************************************************

HsCD00004531      GAGGCCCTGGTGATGCCCACTCTGCGCCAGGCCGCTGAAGACAAGTCCTGGCGCGTCCGC
NM_014225.5       GAGGCCCTGGTGATGCCCACTCTGCGCCAGGCCGCTGAAGACAAGTCCTGGCGCGTCCGC
                  ************************************************************

HsCD00004531      TACATGGTGGCTGACAAGTTCACAGAGCTCCAGAAAGCAGTGGGGCCTGAGATCACCAAG
NM_014225.5       TACATGGTGGCTGACAAGTTCACAGAGCTCCAGAAAGCAGTGGGGCCTGAGATCACCAAG
                  ************************************************************

HsCD00004531      ACAGACCTGGTCCCTGCCTTCCAGAACCTGATGAAAGACTGTGAGGCCGAGGTGAGGGCC
NM_014225.5       ACAGACCTGGTCCCTGCCTTCCAGAACCTGATGAAAGACTGTGAGGCCGAGGTGAGGGCC
                  ************************************************************

HsCD00004531      GCAGCCTCCCACAAGGTCAAAGAGTTCTGTGAAAACCTCTCAGCTGACTGTCGGGAGAAT
NM_014225.5       GCAGCCTCCCACAAGGTCAAAGAGTTCTGTGAAAACCTCTCAGCTGACTGTCGGGAGAAT
                  ************************************************************

HsCD00004531      GTGATCATGTCCCAGATCTTGCCCTGCATCAAGGAGCTGGTGTCCGATGCCAACCAACAT
NM_014225.5       GTGATCATGTCCCAGATCTTGCCCTGCATCAAGGAGCTGGTGTCCGATGCCAACCAACAT
                  ************************************************************

HsCD00004531      GTCAAGTCTGCCCTGGCCTCAGTCATCATGGGTCTCTCTCCCATCTTGGGCAAAGACAAC
NM_014225.5       GTCAAGTCTGCCCTGGCCTCAGTCATCATGGGTCTCTCTCCCATCTTGGGCAAAGACAAC
                  ************************************************************

HsCD00004531      ACCATCGAGCACCTCTTGCCCCTCTTCCTGGCTCAGCTGAAGGATGAGTGCCCTGAGGTA
NM_014225.5       ACCATCGAGCACCTCTTGCCCCTCTTCCTGGCTCAGCTGAAGGATGAGTGCCCTGAGGTA
                  ************************************************************

HsCD00004531      CGGCTGAACATCATCTCTAACCTGGACTGTGTGAACGAGGTGATTGGCATCCGGCAGCTG
NM_014225.5       CGGCTGAACATCATCTCTAACCTGGACTGTGTGAACGAGGTGATTGGCATCCGGCAGCTG
                  ************************************************************

HsCD00004531      TCCCAGTCCCTGCTCCCTGCCATTGTGGAGCTGGCTGAGGACGCCAAGTGGCGGGTGCGG
NM_014225.5       TCCCAGTCCCTGCTCCCTGCCATTGTGGAGCTGGCTGAGGACGCCAAGTGGCGGGTGCGG
                  ************************************************************

HsCD00004531      CTGGCCATCATTGAGTACATGCCCCTCCTGGCTGGACAGCTGGGAGTGGAGTTCTTTGAT
NM_014225.5       CTGGCCATCATTGAGTACATGCCCCTCCTGGCTGGACAGCTGGGAGTGGAGTTCTTTGAT
                  ************************************************************

HsCD00004531      GAGAAACTTAACTCCTTGTGCATGGCCTGGCTTGTGGATCATGTATATGCCATCCGCGAG
NM_014225.5       GAGAAACTTAACTCCTTGTGCATGGCCTGGCTTGTGGATCATGTATATGCCATCCGCGAG
                  ************************************************************

HsCD00004531      GCAGCCACCAGCAACCTGAAGAAGCTAGTGGAAAAGTTTGGGAAGGAGTGGGCCCATGCC
NM_014225.5       GCAGCCACCAGCAACCTGAAGAAGCTAGTGGAAAAGTTTGGGAAGGAGTGGGCCCATGCC
                  ************************************************************

HsCD00004531      ACAATCATCCCCAAGGTCTTGGCCATGTCCGGAGACCCCAACTACCTGCACCGCATGACT
NM_014225.5       ACAATCATCCCCAAGGTCTTGGCCATGTCCGGAGACCCCAACTACCTGCACCGCATGACT
                  ************************************************************

HsCD00004531      ACGCTCTTCTGCATCAATGTGCTGTCTGAGGTCTGTGGGCAGGACATCACCACCAAGCAC
NM_014225.5       ACGCTCTTCTGCATCAATGTGCTGTCTGAGGTCTGTGGGCAGGACATCACCACCAAGCAC
                  ************************************************************

HsCD00004531      ATGCTACCCACGGTTCTGCGCATGGCTGGGGACCCGGTTGCCAATGTCCGCTTCAATGTG
NM_014225.5       ATGCTACCCACGGTTCTGCGCATGGCTGGGGACCCGGTTGCCAATGTCCGCTTCAATGTG
                  ************************************************************

HsCD00004531      GCCAAGTCTCTGCAGAAGATAGGGCCCATCCTGGACAACAGCACCTTGCAGAGTGAAGTC
NM_014225.5       GCCAAGTCTCTGCAGAAGATAGGGCCCATCCTGGACAACAGCACCTTGCAGAGTGAAGTC
                  ************************************************************

HsCD00004531      AAGCCCATCCTAGAGAAGCTGACCCAGGACCAGGATGTGGACGTCAAATACTTTGCCCAG
NM_014225.5       AAGCCCATCCTAGAGAAGCTGACCCAGGACCAGGATGTGGACGTCAAATACTTTGCCCAG
                  ************************************************************

HsCD00004531      GAGGCTCTGACTGTTCTGTCTCTCGCCTTG
NM_014225.5       GAGGCTCTGACTGTTCTGTCTCTCGCCTGA
                  **************************** .

Pathways

NCI : ATR signaling pathway
NCI : ErbB1 downstream signaling
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : PLK1 signaling events
Panther : FGF signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Adaptive Immune System
Reactome : Beta-catenin phosphorylation cascade
Reactome : CTLA4 inhibitory signaling
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Costimulation by the CD28 family
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin D associated events in G1
Reactome : DARPP-32 events
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : Disease
Reactome : E2F mediated regulation of DNA replication
Reactome : ERK/MAPK targets
Reactome : ERKs are inactivated
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : Gene Expression
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Glycolysis
Reactome : Hemostasis
Reactome : Immune System
Reactome : Inhibition of replication initiation of damaged DNA by RB1/E2F1
Reactome : Initiation of Nuclear Envelope Reformation
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : M Phase
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MASTL Facilitates Mitotic Progression
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myoclonic epilepsy of Lafora
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
Reactome : Nonsense-Mediated Decay (NMD)
Reactome : Nuclear Envelope Reassembly
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Opioid Signalling
Reactome : PP2A-mediated dephosphorylation of key metabolic factors
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : Spry regulation of FGF signaling
Reactome : TCF dependent signaling in response to WNT
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
WikiPathway : Glycogen Metabolism
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

UniProt : P30153
UniProt : A8K7B7
HPRD : 16184

Clone

Cloning Information : 24688
HIP Master Clone ID : 55064
Original Clone ID : FLH024688.01L

Organism


TAX_ID : 9606
Species Specific ID: 5518

Genome

Chromosome : 19
Map Location : 19q13.41

Reagents

Labome : PPP2R1A-antibody