DNASU Plasmid Repository • 480.965.5697 | Email

SSRP1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SSRP1
Gene Name:  structure specific recognition protein 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH188095.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00045676

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2127nts        
Open reading frame : 1 to 2127

ATGGCAGAGACACTGGAGTTCAACGACGTCTATCAGGAGGTGAAAGGTTCCATGAATGAT
GGTCGACTGAGGTTGAGCCGTCAGGGCATCATCTTCAAGAATAGCAAGACAGGCAAAGTG
GACAACATCCAGGCTGGGGAGTTAACAGAAGGTATCTGGCGCCGTGTTGCTCTGGGCCAT
GGACTTAAACTGCTTACAAAGAATGGCCATGTCTACAAGTATGATGGCTTCCGAGAATCG
GAGTTTGAGAAACTCTCTGATTTCTTCAAAACTCACTATCGCCTTGAGCTAATGGAGAAG
GACCTTTGTGTGAAGGGCTGGAACTGGGGGACAGTGAAATTTGGTGGGCAGCTGCTTTCC
TTTGACATTGGTGACCAGCCAGTCTTTGAGATACCCCTCAGCAATGTGTCCCAGTGCACC
ACAGGCAAGAATGAGGTGACACTGGAATTCCACCAAAACGATGACGCAGAGGTGTCTCTC
ATGGAGGTGCGCTTCTACGTCCCACCCACCCAGGAGGATGGTGTGGACCCTGTTGAGGCC
TTTGCCCAGAATGTGTTGTCAAAGGCGGATGTAATCCAGGCCACGGGAGATGCCATCTGC
ATCTTCCGGGAGCTGCAGTGTCTGACTCCTCGTGGTCGTTATGACATTCGGATCTACCCC
ACCTTTCTGCACCTGCATGGCAAGACCTTTGACTACAAGATCCCCTACACCACAGTACTG
CGTCTGTTTTTGTTACCCCACAAGGACCAGCGCCAGATGTTCTTTGTGATCAGCCTGGAT
CCCCCAATCAAGCAAGGCCAAACTCGCTACCACTTCCTGATCCTCCTCTTCTCCAAGGAC
GAGGACATTTCGTTGACTCTGAACATGAACGAGGAAGAAGTGGAGAAGCGCTTTGAGGGT
CGGCTCACCAAGAACATGTCAGGATCCCTCTATGAGATGGTCAGCCGGGTCATGAAAGCA
CTGGTAAACCGCAAGATCACAGTGCCAGGCAACTTCCAAGGGCACTCAGGGGCCCAGTGC
ATTACCTGTTCCTACAAGGCAAGCTCAGGACTGCTCTACCCGCTGGAGCGGGGCTTCATC
TACGTCCACAAGCCACCTGTGCACATCCGCTTCGATGAGATCTCCTTTGTCAACTTTGCT
CGTGGTACCACTACTACTCGTTCCTTTGACTTTGAAATTGAGACCAAGCAGGGCACTCAG
TATACCTTCAGCAGCATTGAGAGGGAGGAGTACGGGAAACTGTTTGATTTTGTCAACGCG
AAAAAGCTCAACATCAAAAACCGAGGATTGAAAGAGGGCATGAACCCAAGCTACGATGAA
TATGCTGACTCTGATGAGGACCAGCATGATGCCTACTTGGAGAGGATGAAGGAGGAAGGC
AAGATCCGGGAGGAGAATGCCAATGACAGCAGCGATGACTCAGGAGAAGAAACCGATGAG
TCATTCAACCCAGGTGAAGAGGAGGAAGATGTGGCAGAGGAGTTTGACAGCAACGCCTCT
GCCAGCTCCTCCAGTAATGAGGGTGACAGTGACCGGGATGAGAAGAAGCGGAAACAGCTC
AAAAAGGCCAAGATGGCCAAGGACCGCAAGAGCCGCAAGAAGCCTGTGGAGGTGAAGAAG
GGCAAAGACCCCAATGCCCCCAAGAGGCCCATGTCTGCATACATGCTGTGGCTCAATGCC
AGCCGAGAGAAGATCAAGTCAGACCATCCTGGCATCAGCATCACGGATCTTTCCAAGAAG
GCAGGCGAGATCTGGAAGGGAATGTCCAAAGAGAAGAAAGAGGAGTGGGATCGCAAGGCT
GAGGATGCCAGGAGGGACTATGAAAAAGCCATGAAAGAATATGAAGGGGGCCGAGGCGAG
TCTTCTAAGAGGGACAAGTCAAAGAAGAAGAAGAAAGTAAAGGTAAAGATGGAAAAGAAA
TCCACGCCCTCTAGGGGCTCATCATCCAAGTCGTCCTCAAGGCAGCTAAGCGAGAGCTTC
AAGAGCAAAGAGTTTGTGTCTAGTGATGAGAGCTCTTCGGGAGAGAACAAGAGCAAAAAG
AAGAGGAGGAGGAGCGAGGACTCTGAAGAAGAAGAACTAGCCAGTACTCCCCCCAGCTCA
GAGGACTCAGCGTCAGGATCCGATGAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2178
Start on reference sequence 49
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SSRP1
Symbol Nomenclature : SSRP1
SYNONYM : FACT; FACT80; T160
Designation : FACT 80 kDa subunit|FACT complex subunit SSRP1|FACTp80|chromatin-specific transcription elongation factor 80 kDa subunit|cisplatin-DNA SSRP|facilitates chromatin remodeling 80 kDa subunit|facilitates chromatin transcription complex 80 kDa subunit|facilitates chromatin transcription complex subunit SSRP1|hSSRP1|high mobility group box|recombination signal sequence recognition protein 1|structure-specific recognition protein 1
Full Nomenclature : structure specific recognition protein 1
GENEID : 6749
HGNC : 11327
MIM : 604328
Vega : OTTHUMG00000167024
Target GenBank: BC005116

 

Pathways

NCI : Validated transcriptional targets of TAp63 isoforms
Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Late Phase of HIV Life Cycle
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Transcription
Reactome : Transcription of the HIV genome

Protein

SMART domain : HMG : high mobility group
UniProt : Q08945
HPRD : 05061

Clone

Cloning Information : 188095
HIP Master Clone ID : 163039
Original Clone ID : FLH188095.01X

Organism


TAX_ID : 9606
Species Specific ID: 6749

Genome

Chromosome : 11
Map Location : 11q12
Ensembl : ENSG00000149136

Reagents

Labome : SSRP1-antibody