DNASU Plasmid Repository • 480.965.5697 | Email

LDLR (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LDLR
Gene Name:  low density lipoprotein receptor
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH022841.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004644

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2583nts         Open reading frame : 1 to 2583
Reference Sequence Alignment

ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
ACTGCAGTGGGCGACAGATGTGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
GGCGTCTCTTCCTATGACACCGTCATCAGCAGGGACATCCAGGCCCCCGACGGGCTGGCT
GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
AAACTTCACTCCATCTCAAGCATCGATGTCAATGGGGGCAACCGGAAGACCATCTTGGAG
GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTCCTCTTCCACAACCTCACCCAG
CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
ACAACCACCCGGCCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2653
Start on reference sequence 71
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LDLR
Symbol Nomenclature : LDLR
SYNONYM : FH; FHC; LDLCQ2
Designation : LDL receptor|low-density lipoprotein receptor|low-density lipoprotein receptor class A domain-containing protein 3
Full Nomenclature : low density lipoprotein receptor
GENEID : 3949
GI : 61362287
GenBank Accession : AY890252
HGNC : 6547
MIM : 606945
Vega : OTTHUMG00000171935
Target GenBank: BC014514

 

Reference Sequence Alignment

  

HsCD00004644        ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_000527.4         ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_001195799.1      ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_001195798.1      ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
                    ************************************************************

HsCD00004644        ACTGCAGTGGGCGACAGATGTGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_000527.4         ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_001195799.1      ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_001195798.1      ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
                    ******************** ***************************************

HsCD00004644        TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_000527.4         TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_001195799.1      TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_001195798.1      TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
                    ************************************************************

HsCD00004644        GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
NM_000527.4         GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
NM_001195799.1      GAGACGT-----------------------------------------------------
NM_001195798.1      GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
                    *******                                                     

HsCD00004644        CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
NM_000527.4         CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
NM_001195799.1      ------------------------------------------------------------
NM_001195798.1      CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
                                                                                

HsCD00004644        GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_000527.4         GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_001195799.1      ----------GCTCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_001195798.1      GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
                              *  ***********************************************

HsCD00004644        TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_000527.4         TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_001195799.1      TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_001195798.1      TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
                    ************************************************************

HsCD00004644        GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_000527.4         GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_001195799.1      GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_001195798.1      GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
                    ************************************************************

HsCD00004644        ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_000527.4         ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_001195799.1      ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_001195798.1      ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
                    ************************************************************

HsCD00004644        CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_000527.4         CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_001195799.1      CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_001195798.1      CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
                    ************************************************************

HsCD00004644        GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_000527.4         GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_001195799.1      GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_001195798.1      GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
                    ************************************************************

HsCD00004644        GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_000527.4         GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_001195799.1      GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_001195798.1      GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
                    ************************************************************

HsCD00004644        TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_000527.4         TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_001195799.1      TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_001195798.1      TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
                    ************************************************************

HsCD00004644        TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_000527.4         TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_001195799.1      TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_001195798.1      TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
                    ************************************************************

HsCD00004644        AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_000527.4         AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_001195799.1      AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_001195798.1      AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
                    ************************************************************

HsCD00004644        GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_000527.4         GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_001195799.1      GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_001195798.1      GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
                    ************************************************************

HsCD00004644        AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_000527.4         AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_001195799.1      AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_001195798.1      AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
                    ************************************************************

HsCD00004644        CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_000527.4         CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_001195799.1      CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_001195798.1      CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
                    ************************************************************

HsCD00004644        CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_000527.4         CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_001195799.1      CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_001195798.1      CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
                    ************************************************************

HsCD00004644        GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_000527.4         GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_001195799.1      GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_001195798.1      GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
                    ************************************************************

HsCD00004644        CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_000527.4         CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_001195799.1      CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_001195798.1      CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
                    ************************************************************

HsCD00004644        AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_000527.4         AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_001195799.1      AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_001195798.1      AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
                    ************************************************************

HsCD00004644        ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_000527.4         ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_001195799.1      ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_001195798.1      ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
                    ************************************************************

HsCD00004644        GGCGTCTCTTCCTATGACACCGTCATCAGCAGGGACATCCAGGCCCCCGACGGGCTGGCT
NM_000527.4         GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
NM_001195799.1      GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
NM_001195798.1      GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
                    ********************************.***************************

HsCD00004644        GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_000527.4         GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_001195799.1      GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_001195798.1      GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
                    ************************************************************

HsCD00004644        GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_000527.4         GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_001195799.1      GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_001195798.1      GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
                    ************************************************************

HsCD00004644        GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_000527.4         GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_001195799.1      GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_001195798.1      GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
                    ************************************************************

HsCD00004644        AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_000527.4         AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_001195799.1      AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_001195798.1      AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
                    ************************************************************

HsCD00004644        CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_000527.4         CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_001195799.1      CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_001195798.1      CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
                    ************************************************************

HsCD00004644        AAACTTCACTCCATCTCAAGCATCGATGTCAATGGGGGCAACCGGAAGACCATCTTGGAG
NM_000527.4         AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
NM_001195799.1      AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
NM_001195798.1      AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
                    ******************************** ***************************

HsCD00004644        GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_000527.4         GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_001195799.1      GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_001195798.1      GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
                    ************************************************************

HsCD00004644        ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_000527.4         ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_001195799.1      ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_001195798.1      ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
                    ************************************************************

HsCD00004644        TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTCCTCTTCCACAACCTCACCCAG
NM_000527.4         TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
NM_001195799.1      TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
NM_001195798.1      TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
                    ************************************** *********************

HsCD00004644        CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_000527.4         CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_001195799.1      CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_001195798.1      CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
                    ************************************************************

HsCD00004644        TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_000527.4         TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_001195799.1      TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_001195798.1      TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
                    ************************************************************

HsCD00004644        GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_000527.4         GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_001195799.1      GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_001195798.1      GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
                    ************************************************************

HsCD00004644        ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_000527.4         ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_001195799.1      ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_001195798.1      ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
                    ************************************************************

HsCD00004644        ACAACCACCCGGCCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_000527.4         ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_001195799.1      ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_001195798.1      ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
                    ***********.************************************************

HsCD00004644        ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_000527.4         ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_001195799.1      ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_001195798.1      ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
                    ************************************************************

HsCD00004644        GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_000527.4         GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_001195799.1      GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_001195798.1      GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
                    ************************************************************

HsCD00004644        TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_000527.4         TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_001195799.1      TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_001195798.1      TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
                    ************************************************************

HsCD00004644        ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_000527.4         ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_001195799.1      ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_001195798.1      ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
                    ************************************************************

HsCD00004644        AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_000527.4         AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_001195799.1      AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_001195798.1      AACCAGGACGGCTACAGCTACCCCTCGATGGTCAG------TCTGGAGGATGACGTGGCG
                    **************************** . : *       *******************

HsCD00004644        TAG
NM_000527.4         TGA
NM_001195799.1      TGA
NM_001195798.1      TGA
                    *..

Pathways

Reactome : Chylomicron-mediated lipid transport
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : LDL-mediated lipid transport
Reactome : Lipid digestion, mobilization, and transport
Reactome : Lipoprotein metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Retinoid metabolism and transport
Reactome : Signal Transduction
Reactome : Visual phototransduction
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Folate Metabolism
WikiPathway : SREBF and miR33 in cholesterol and lipid homeostasis
WikiPathway : Selenium Pathway
WikiPathway : Statin Pathway
WikiPathway : Vitamin B12 Metabolism
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : EGF : Epidermal growth factor-like domain.
SMART domain : LY : Low-density lipoprotein-receptor YWTD domain
SMART domain : EGF_CA : Calcium-binding EGF-like domain
SMART domain : LDLa : Low-density lipoprotein receptor domain class A
UniProt : B4DR00
UniProt : P01130
UniProt : B4DTQ3
UniProt : B4DJZ8
UniProt : B4DII3
UniProt : Q59FQ1
HPRD : 06091

Clone

Cloning Information : 22841
HIP Master Clone ID : 53217
Original Clone ID : FLH022841.01X

Organism


TAX_ID : 9606
Species Specific ID: 3949

Genome

Chromosome : 19
Map Location : 19p13.2
Ensembl : ENSG00000130164

Reagents

Labome : LDLR-antibody