DNASU Plasmid Repository • 480.965.5697 | Email

ATP5A1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATP5A1
Gene Name:  ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023402.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004704

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1662nts         Open reading frame : 1 to 1662
Reference Sequence Alignment

ATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTG
GTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAAC
ACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTT
GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTT
CCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGA
AAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1715
Start on reference sequence 54
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATP5A1
Symbol Nomenclature : ATP5A1
SYNONYM : ATP5A; ATP5AL2; ATPM; HEL-S-123m; MC5DN4; MOM2; OMR; ORM; hATP1
Designation : ATP synthase alpha chain, mitochondrial|ATP synthase subunit alpha, mitochondrial|ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle|ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2|ATP sythase (F1-ATPase) alpha subunit|epididymis secretory sperm binding protein Li 123m|mitochondrial ATP synthetase, oligomycin-resistant
Full Nomenclature : ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
GENEID : 498
GI : 60653976
GenBank Accession : AY892764
HGNC : 823
MIM : 164360
Vega : OTTHUMG00000132637
Target GenBank: BC019310

 

Reference Sequence Alignment

  

HsCD00004704        ATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTG
NM_001257334.1      ATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTG
NM_004046.5         ATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTG
NM_001001935.2      ------------------------------------------------------------
NM_001001937.1      ATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTG
NM_001257335.1      ------------------------------------------------------------
                                                                                

HsCD00004704        GTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAAC
NM_001257334.1      GTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAAC
NM_004046.5         GTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAAC
NM_001001935.2      ------------------------------------------------------------
NM_001001937.1      GTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAAC
NM_001257335.1      ------------------------------------------------------------
                                                                                

HsCD00004704        ACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTT
NM_001257334.1      ACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTT
NM_004046.5         ACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTT
NM_001001935.2      ------------------------------ATGTCCTCTATTCTTGAAGAGCGTATTCTT
NM_001001937.1      ACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTT
NM_001257335.1      ------------------------------ATGTCCTCTATTCTTGAAGAGCGTATTCTT
                                                  ******************************

HsCD00004704        GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
NM_001257334.1      GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
NM_004046.5         GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
NM_001001935.2      GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
NM_001001937.1      GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
NM_001257335.1      GGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGT
                    ************************************************************

HsCD00004704        ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
NM_001257334.1      ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
NM_004046.5         ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
NM_001001935.2      ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
NM_001001937.1      ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
NM_001257335.1      ATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCA
                    ************************************************************

HsCD00004704        GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
NM_001257334.1      GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
NM_004046.5         GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
NM_001001935.2      GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
NM_001001937.1      GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
NM_001257335.1      GGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
                    ************************************************************

HsCD00004704        AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTT
NM_001257334.1      AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGGT
NM_004046.5         AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTT
NM_001001935.2      AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTT
NM_001001937.1      AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTT
NM_001257335.1      AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTT
                    ********************************************************** *

HsCD00004704        CCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGA
NM_001257334.1      CCAATTG-----------------------------------------------------
NM_004046.5         CCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGA
NM_001001935.2      CCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGA
NM_001001937.1      CCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGA
NM_001257335.1      CCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGA
                    ***.***                                                     

HsCD00004704        AAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
NM_001257334.1      -------------GTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
NM_004046.5         AAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
NM_001001935.2      AAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
NM_001001937.1      AAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
NM_001257335.1      AAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATT
                                 ***********************************************

HsCD00004704        CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
NM_001257334.1      CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
NM_004046.5         CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
NM_001001935.2      CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
NM_001001937.1      CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
NM_001257335.1      CCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTG
                    ************************************************************

HsCD00004704        CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
NM_001257334.1      CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
NM_004046.5         CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
NM_001001935.2      CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
NM_001001937.1      CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
NM_001257335.1      CCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCA
                    ************************************************************

HsCD00004704        ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
NM_001257334.1      ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
NM_004046.5         ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
NM_001001935.2      ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
NM_001001937.1      ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
NM_001257335.1      ATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAG
                    ************************************************************

HsCD00004704        AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
NM_001257334.1      AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
NM_004046.5         AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
NM_001001935.2      AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
NM_001001937.1      AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
NM_001257335.1      AAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
                    ************************************************************

HsCD00004704        AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
NM_001257334.1      AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
NM_004046.5         AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
NM_001001935.2      AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
NM_001001937.1      AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
NM_001257335.1      AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
                    ************************************************************

HsCD00004704        GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
NM_001257334.1      GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
NM_004046.5         GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
NM_001001935.2      GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
NM_001001937.1      GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
NM_001257335.1      GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTT
                    ************************************************************

HsCD00004704        AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
NM_001257334.1      AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
NM_004046.5         AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
NM_001001935.2      AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
NM_001001937.1      AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
NM_001257335.1      AGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCT
                    ************************************************************

HsCD00004704        TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
NM_001257334.1      TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
NM_004046.5         TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
NM_001001935.2      TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
NM_001001937.1      TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
NM_001257335.1      TACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGAT
                    ************************************************************

HsCD00004704        GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
NM_001257334.1      GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
NM_004046.5         GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
NM_001001935.2      GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
NM_001001937.1      GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
NM_001257335.1      GTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGT
                    ************************************************************

HsCD00004704        GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
NM_001257334.1      GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
NM_004046.5         GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
NM_001001935.2      GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
NM_001001937.1      GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
NM_001257335.1      GGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTAC
                    ************************************************************

HsCD00004704        ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
NM_001257334.1      ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
NM_004046.5         ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
NM_001001935.2      ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
NM_001001937.1      ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
NM_001257335.1      ATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
                    ************************************************************

HsCD00004704        TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
NM_001257334.1      TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
NM_004046.5         TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
NM_001001935.2      TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
NM_001001937.1      TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
NM_001257335.1      TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCT
                    ************************************************************

HsCD00004704        GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
NM_001257334.1      GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
NM_004046.5         GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
NM_001001935.2      GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
NM_001001937.1      GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
NM_001257335.1      GCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTAT
                    ************************************************************

HsCD00004704        CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
NM_001257334.1      CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
NM_004046.5         CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
NM_001001935.2      CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
NM_001001937.1      CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
NM_001257335.1      CGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTT
                    ************************************************************

HsCD00004704        TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
NM_001257334.1      TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
NM_004046.5         TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
NM_001001935.2      TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
NM_001001937.1      TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
NM_001257335.1      TTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCT
                    ************************************************************

HsCD00004704        ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
NM_001257334.1      ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
NM_004046.5         ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
NM_001001935.2      ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
NM_001001937.1      ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
NM_001257335.1      ATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAG
                    ************************************************************

HsCD00004704        CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
NM_001257334.1      CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
NM_004046.5         CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
NM_001001935.2      CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
NM_001001937.1      CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
NM_001257335.1      CCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAA
                    ************************************************************

HsCD00004704        GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
NM_001257334.1      GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
NM_004046.5         GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
NM_001001935.2      GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
NM_001001937.1      GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
NM_001257335.1      GCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
                    ************************************************************

HsCD00004704        AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTTG
NM_001257334.1      AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA
NM_004046.5         AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA
NM_001001935.2      AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA
NM_001001937.1      AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA
NM_001257335.1      AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA
                    ****************************************:.

Pathways

Panther : ATP synthesis
Reactome : Formation of ATP by chemiosmotic coupling
Reactome : Metabolism
Reactome : Metabolism of proteins
Reactome : Mitochondrial protein import
Reactome : Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins.
Reactome : The citric acid (TCA) cycle and respiratory electron transport
WikiPathway : Electron Transport Chain
WikiPathway : Oxidative phosphorylation

Protein

UniProt : P25705
HPRD : 01258

Clone

Cloning Information : 23402
HIP Master Clone ID : 53778
Original Clone ID : FLH023402.01L

Organism


TAX_ID : 9606
Species Specific ID: 498

Genome

Chromosome : 18
Map Location : 18q21
Ensembl : ENSG00000152234

Reagents

Labome : ATP5A1-antibody