DNASU Plasmid Repository • 480.965.5697 | Email

PPP2CB (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPP2CB
Gene Name:  protein phosphatase 2, catalytic subunit, beta isozyme
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019834.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000499

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 930nts         Open reading frame : 1 to 930
Reference Sequence Alignment

ATGGACGACAAGGCGTTCACCAAGGAGCTGGACCAGTGGGTCGAGCAGCTGAACGAGTGT
AAGCAGCTGAACGAGAACCAAGTGCGGACGCTGTGCGAGAAGGCAAAGGAAATTTTAACA
AAAGAATCAAATGTGCAAGAGGTTCGTTGCCCTGTTACTGTCTGTGGAGATGTGCATGGT
CAATTTCATGATCTTATGGAACTCTTTAGAATTGGTGGAAAATCACCGGATACAAACTAC
TTATTCATGGGTGACTATGTAGACAGAGGATATTATTCAGTGGAGACTGTGACTCTTCTT
GTAGCATTAAAGGTGCGTTATCCAGAACGCATTACAATATTGAGAGGAAATCACGAAAGC
CGACAAATTACCCAAGTATATGGCTTTTATGATGAATGTCTGCGAAAGTATGGGAATGCC
AACGTTTGGAAATATTTTACAGATCTCTTTGATTATCTTCCACTTACAGCTTTAGTAGAT
GGACAGATATTCTGCCTCCATGGTGGCCTCTCTCCATCCATAGACACACTGGATCATATA
AGAACCCTGGATCGTTTACAGGAAGTTCCACATGAGGGCCCAATGTGTGATCTGTTATGG
TCAGATCCAGATGATCGTGGTGGATGGGGTATTTCACCACGTGGTGCTGGCTACACATTT
GGACAAGACATTTCTGAAACCTTTAACCATGCCAATGGTCTCACACTGGTTTCTCGTGCC
CACCAGCTTGTAATGGAGGGATACAATTGGTGTCATGATCGGAATGTGGTTACCATTTTC
AGTGCACCCAATTACTGTTATCGTTGTGGGAACCAGGCTGCTATCATGGAATTAGATGAC
ACTTTAAAATATTCCTTCCTTCAATTTGACCCAGCGCCTCGTCGTGGTGAGCCTCATGTT
ACACGGCGCACCCCAGACTACTTCCTATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 951
Start on reference sequence 22
Mutations:
None
Discrepancy:
g544a,A182T; g873a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPP2CB
Symbol Nomenclature : PPP2CB
SYNONYM : PP2Abeta; PP2CB
Designation : PP2A-beta|protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform|protein phosphatase 2, catalytic subunit, beta isoform|protein phosphatase 2A catalytic subunit, beta isoform|protein phosphatase type 2A catalytic subunit|serine/threonine protein phosphatase 2A, catalytic subunit, beta isoform|serine/threonine-protein phosphatase 2A catalytic subunit beta isoform
Full Nomenclature : protein phosphatase 2, catalytic subunit, beta isozyme
GENEID : 5516
GI : 61356061
GenBank Accession : AY888259
HGNC : 9300
MIM : 176916
Vega : OTTHUMG00000163949
Target GenBank: NM_004156

 

Reference Sequence Alignment

  

HsCD00000499        ATGGACGACAAGGCGTTCACCAAGGAGCTGGACCAGTGGGTCGAGCAGCTGAACGAGTGT
NM_002715.2         ATGGACGAGAAGGTGTTCACCAAGGAGCTGGACCAGTGGATCGAGCAGCTGAACGAGTGC
NM_001009552.1      ATGGACGACAAGGCGTTCACCAAGGAGCTGGACCAGTGGGTCGAGCAGCTGAACGAGTGT
                    ******** **** *************************.******************* 

HsCD00000499        AAGCAGCTGAACGAGAACCAAGTGCGGACGCTGTGCGAGAAGGCAAAGGAAATTTTAACA
NM_002715.2         AAGCAGCTGTCCGAGTCCCAGGTCAAGAGCCTCTGCGAGAAGGCTAAAGAAATCCTGACA
NM_001009552.1      AAGCAGCTGAACGAGAACCAAGTGCGGACGCTGTGCGAGAAGGCAAAGGAAATTTTAACA
                    *********:.****:.***.** ..**  ** ***********:**.*****  *.***

HsCD00000499        AAAGAATCAAATGTGCAAGAGGTTCGTTGCCCTGTTACTGTCTGTGGAGATGTGCATGGT
NM_002715.2         AAAGAATCCAACGTGCAAGAGGTTCGATGTCCAGTTACTGTCTGTGGAGATGTGCATGGG
NM_001009552.1      AAAGAATCAAATGTGCAAGAGGTTCGTTGCCCTGTTACTGTCTGTGGAGATGTGCATGGT
                    ********.** **************:** **:************************** 

HsCD00000499        CAATTTCATGATCTTATGGAACTCTTTAGAATTGGTGGAAAATCACCGGATACAAACTAC
NM_002715.2         CAATTTCATGATCTCATGGAACTGTTTAGAATTGGTGGCAAATCACCAGATACAAATTAC
NM_001009552.1      CAATTTCATGATCTTATGGAACTCTTTAGAATTGGTGGAAAATCACCGGATACAAACTAC
                    ************** ******** **************.********.******** ***

HsCD00000499        TTATTCATGGGTGACTATGTAGACAGAGGATATTATTCAGTGGAGACTGTGACTCTTCTT
NM_002715.2         TTGTTTATGGGAGATTATGTTGACAGAGGATATTATTCAGTTGAAACAGTTACACTGCTT
NM_001009552.1      TTATTCATGGGTGACTATGTAGACAGAGGATATTATTCAGTGGAGACTGTGACTCTTCTT
                    **.** *****:** *****:******************** **.**:** **:** ***

HsCD00000499        GTAGCATTAAAGGTGCGTTATCCAGAACGCATTACAATATTGAGAGGAAATCACGAAAGC
NM_002715.2         GTAGCTCTTAAGGTTCGTTACCGTGAACGCATCACCATTCTTCGAGGGAATCATGAGAGC
NM_001009552.1      GTAGCATTAAAGGTGCGTTATCCAGAACGCATTACAATATTGAGAGGAAATCACGAAAGC
                    *****: *:***** ***** * :******** **.**: * .****.***** **.***

HsCD00000499        CGACAAATTACCCAAGTATATGGCTTTTATGATGAATGTCTGCGAAAGTATGGGAATGCC
NM_002715.2         AGACAGATCACACAAGTTTATGGTTTCTATGATGAATGTTTAAGAAAATATGGAAATGCA
NM_001009552.1      CGACAAATTACCCAAGTATATGGCTTTTATGATGAATGTCTGCGAAAGTATGGGAATGCC
                    .****.** **.*****:***** ** ************ *..****.*****.*****.

HsCD00000499        AACGTTTGGAAATATTTTACAGATCTCTTTGATTATCTTCCACTTACAGCTTTAGTAGAT
NM_002715.2         AATGTTTGGAAATATTTTACAGATCTTTTTGACTATCTTCCTCTCACTGCCTTGGTGGAT
NM_001009552.1      AACGTTTGGAAATATTTTACAGATCTCTTTGATTATCTTCCACTTACAGCTTTAGTAGAT
                    ** *********************** ***** ********:** **:** **.**.***

HsCD00000499        GGACAGATATTCTGCCTCCATGGTGGCCTCTCTCCATCCATAGACACACTGGATCATATA
NM_002715.2         GGGCAGATCTTCTGTCTACATGGTGGTCTCTCGCCATCTATAGATACACTGGATCATATC
NM_001009552.1      GGACAGATATTCTGCCTCCATGGTGGCCTCTCTCCATCCATAGACACACTGGATCATATA
                    **.*****.***** **.******** ***** ***** ***** **************.

HsCD00000499        AGAACCCTGGATCGTTTACAGGAAGTTCCACATGAGGGCCCAATGTGTGATCTGTTATGG
NM_002715.2         AGAGCACTTGATCGCCTACAAGAAGTTCCCCATGAGGGTCCAATGTGTGACTTGCTGTGG
NM_001009552.1      AGAGCCCTGGATCGTTTACAGGAAGTTCCACATGAGGGCCCAATGTGTGATCTGTTATGG
                    ***.*.** *****  ****.********.******** ***********  ** *.***

HsCD00000499        TCAGATCCAGATGATCGTGGTGGATGGGGTATTTCACCACGTGGTGCTGGCTACACATTT
NM_002715.2         TCAGATCCAGATGACCGTGGTGGTTGGGGTATATCTCCTCGAGGAGCTGGTTACACCTTT
NM_001009552.1      TCAGATCCAGATGATCGTGGTGGATGGGGTATTTCACCACGTGGTGCTGGCTACACATTT
                    ************** ********:********:**:**:**:**:***** *****.***

HsCD00000499        GGACAAGACATTTCTGAAACCTTTAACCATGCCAATGGTCTCACACTGGTTTCTCGTGCC
NM_002715.2         GGGCAAGATATTTCTGAGACATTTAATCATGCCAATGGCCTCACGTTGGTGTCTAGAGCT
NM_001009552.1      GGACAAGACATTTCTGAAACCTTTAACCATGCCAATGGTCTCACACTGGTTTCTCGTGCC
                    **.***** ********.**.***** *********** *****. **** ***.*:** 

HsCD00000499        CACCAGCTTGTAATGGAGGGATACAATTGGTGTCATGATCGGAATGTGGTTACCATTTTC
NM_002715.2         CACCAGCTAGTGATGGAGGGATATAACTGGTGCCATGACCGGAATGTAGTAACGATTTTC
NM_001009552.1      CACCAGCTTGTAATGGAGGGATACAATTGGTGTCATGATCGGAATGTGGTTACCATTTTC
                    ********:**.*********** ** ***** ***** ********.**:** ******

HsCD00000499        AGTGCACCCAATTACTGTTATCGTTGTGGGAACCAGGCTGCTATCATGGAATTAGATGAC
NM_002715.2         AGTGCTCCAAACTATTGTTATCGTTGTGGTAACCAAGCTGCAATCATGGAACTTGACGAT
NM_001009552.1      AGTGCACCCAATTACTGTTATCGTTGTGGGAACCAGGCTGCTATCATGGAATTAGATGAC
                    *****:**.** ** ************** *****.*****:********* *:** ** 

HsCD00000499        ACTTTAAAATATTCCTTCCTTCAATTTGACCCAGCGCCTCGTCGTGGTGAGCCTCATGTT
NM_002715.2         ACTCTAAAATACTCTTTCTTGCAGTTTGACCCAGCACCTCGTAGAGGCGAGCCACATGTT
NM_001009552.1      ACTTTAAAATATTCCTTCCTTCAATTTGACCCAGCGCCTCGTCGTGGTGAGCCTCATGTT
                    *** ******* ** *** * **.***********.******.*:** *****:******

HsCD00000499        ACACGGCGCACCCCAGACTACTTCCTATAG
NM_002715.2         ACTCGTCGTACCCCAGACTACTTCCTGTAA
NM_001009552.1      ACACGGCGCACCCCAGACTACTTCCTATAA
                    **:** ** *****************.**.

Pathways

NCI : TGF-beta receptor signaling
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Wnt signaling pathway
Panther : p53 pathway
Panther : p53 pathway by glucose deprivation
Panther : p53 pathway feedback loops 2
Reactome : Activated TLR4 signalling
Reactome : Adaptive Immune System
Reactome : Beta-catenin phosphorylation cascade
Reactome : CTLA4 inhibitory signaling
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Costimulation by the CD28 family
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin D associated events in G1
Reactome : DARPP-32 events
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : Disease
Reactome : E2F mediated regulation of DNA replication
Reactome : ERK/MAPK targets
Reactome : ERKs are inactivated
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Glycolysis
Reactome : Hemostasis
Reactome : Immune System
Reactome : Inhibition of replication initiation of damaged DNA by RB1/E2F1
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : M Phase
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MASTL Facilitates Mitotic Progression
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myoclonic epilepsy of Lafora
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Opioid Signalling
Reactome : PP2A-mediated dephosphorylation of key metabolic factors
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : Spry regulation of FGF signaling
Reactome : TCF dependent signaling in response to WNT
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
WikiPathway : Diurnally regulated genes with circadian orthologs
WikiPathway : Glycogen Metabolism
WikiPathway : Monoamine Transport
WikiPathway : Serotonin Transporter Activity
WikiPathway : Wnt Signaling Pathway and Pluripotency

Clone

Cloning Information : 19834
HIP Master Clone ID : 34344
Original Clone ID : FLH019834.01X

Organism


TAX_ID : 9606
Species Specific ID: 5516

Genome

Chromosome : 8
Map Location : 8p12
Ensembl : ENSG00000104695

Reagents

Labome : PPP2CB-antibody