DNASU Plasmid Repository • 480.965.5697 | Email

IGFBP6 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IGFBP6
Gene Name:  insulin-like growth factor binding protein 6
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054709.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000050

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 723nts         Open reading frame : 1 to 723
Reference Sequence Alignment

ATGACCCCCCACAGGCTGCTGCCACCGCTGCTGCTGCTGCTAGCTCTGCTGCTCGCTGCC
AGCCCAGGAGGCGCCTTGGCGCGGTGCCCAGGCTGCGGGCAAGGGGTGCAGGCGGGTTGT
CCAGGGGGCTGCGTGGAGGAGGAGGATGGGGGGTCGCCAGCCGAGGGCTGCGCGGAAGCT
GAGGGCTGTCTCAGGAGGGAGGGGCAGGAGTGCGGGGTCTACACCCCTAACTGCGCCCCA
GGACTGCAGTGCCATCCGCCCAAGGACGACGAGGCGCCTTTGCGGGCGCTGCTGCTCGGC
GGAGGCCGCTGCCTTCCGGCCCGCGCGCCAGCTGTTGCAGAGGAGAATCCTAAGGAGAGT
AAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAAT
CCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATG
GGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGA
GGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAG
TGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAG
TCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGC
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 776
Start on reference sequence 54
Mutations:
None
Discrepancy:
c301g,R101G; t330a
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IGFBP6
Symbol Nomenclature : IGFBP6
SYNONYM : IBP6
Designation : IBP-6|IGF binding protein 6|IGF-binding protein 6|IGFBP-6|insulin-like growth factor-binding protein 6
Full Nomenclature : insulin-like growth factor binding protein 6
GENEID : 3489
GI : 60812694
GenBank Accession : AY893188
HGNC : 5475
MIM : 146735
Vega : OTTHUMG00000169773
Target GenBank: NM_002178

 

Reference Sequence Alignment

  

HsCD00000050      ATGACCCCCCACAGGCTGCTGCCACCGCTGCTGCTGCTGCTAGCTCTGCTGCTCGCTGCC
NM_002178.2       ATGACCCCCCACAGGCTGCTGCCACCGCTGCTGCTGCTGCTAGCTCTGCTGCTCGCTGCC
                  ************************************************************

HsCD00000050      AGCCCAGGAGGCGCCTTGGCGCGGTGCCCAGGCTGCGGGCAAGGGGTGCAGGCGGGTTGT
NM_002178.2       AGCCCAGGAGGCGCCTTGGCGCGGTGCCCAGGCTGCGGGCAAGGGGTGCAGGCGGGTTGT
                  ************************************************************

HsCD00000050      CCAGGGGGCTGCGTGGAGGAGGAGGATGGGGGGTCGCCAGCCGAGGGCTGCGCGGAAGCT
NM_002178.2       CCAGGGGGCTGCGTGGAGGAGGAGGATGGGGGGTCGCCAGCCGAGGGCTGCGCGGAAGCT
                  ************************************************************

HsCD00000050      GAGGGCTGTCTCAGGAGGGAGGGGCAGGAGTGCGGGGTCTACACCCCTAACTGCGCCCCA
NM_002178.2       GAGGGCTGTCTCAGGAGGGAGGGGCAGGAGTGCGGGGTCTACACCCCTAACTGCGCCCCA
                  ************************************************************

HsCD00000050      GGACTGCAGTGCCATCCGCCCAAGGACGACGAGGCGCCTTTGCGGGCGCTGCTGCTCGGC
NM_002178.2       GGACTGCAGTGCCATCCGCCCAAGGACGACGAGGCGCCTTTGCGGGCGCTGCTGCTCGGC
                  ************************************************************

HsCD00000050      GGAGGCCGCTGCCTTCCGGCCCGCGCGCCAGCTGTTGCAGAGGAGAATCCTAAGGAGAGT
NM_002178.2       CGAGGCCGCTGCCTTCCGGCCCGCGCGCCTGCTGTTGCAGAGGAGAATCCTAAGGAGAGT
                   ****************************:******************************

HsCD00000050      AAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAAT
NM_002178.2       AAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAAT
                  ************************************************************

HsCD00000050      CCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATG
NM_002178.2       CCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATG
                  ************************************************************

HsCD00000050      GGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGA
NM_002178.2       GGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGA
                  ************************************************************

HsCD00000050      GGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAG
NM_002178.2       GGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAG
                  ************************************************************

HsCD00000050      TGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAG
NM_002178.2       TGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAG
                  ************************************************************

HsCD00000050      TCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGC
NM_002178.2       TCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGC
                  ************************************************************

HsCD00000050      TAG
NM_002178.2       TAA
                  **.

Pathways

Reactome : Metabolism of proteins
Reactome : Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs)
WikiPathway : Myometrial Relaxation and Contraction Pathways

Clone

Cloning Information : 54709
HIP Master Clone ID : 12987
Original Clone ID : FLH054709.01X

Organism


TAX_ID : 9606
Species Specific ID: 3489

Genome

Chromosome : 12
Map Location : 12q13
Ensembl : ENSG00000167779

Reagents

Labome : IGFBP6-antibody