DNASU Plasmid Repository • 480.965.5697 | Email

YWHAE (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAE
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH018704.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00005018

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 768nts         Open reading frame : 1 to 768
Reference Sequence Alignment

ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 828
Start on reference sequence 61
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAE
Symbol Nomenclature : YWHAE
SYNONYM : 14-3-3E; HEL2; KCIP-1; MDCR; MDS
Designation : 14-3-3 epsilon|14-3-3 protein epsilon|epididymis luminal protein 2|mitochondrial import stimulation factor L subunit|protein kinase C inhibitor protein-1|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide|tyrosine 3/tryptophan 5 -monooxygenase activation protein, epsilon polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
GENEID : 7531
GI : 60654186
GenBank Accession : AY892869
HGNC : 12851
MIM : 605066
Vega : OTTHUMG00000134316
Target GenBank: U54778

 

Reference Sequence Alignment

  

HsCD00005018        ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
XM_005256784.1      ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
NM_006761.4         ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
                    ************************************************************

HsCD00005018        GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
XM_005256784.1      GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
NM_006761.4         GACGAAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAA
                    ************************************************************

HsCD00005018        GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
XM_005256784.1      GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
NM_006761.4         GAAAGAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGG
                    ************************************************************

HsCD00005018        AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
XM_005256784.1      AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
NM_006761.4         AGAATAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAA
                    ************************************************************

HsCD00005018        ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
XM_005256784.1      ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
NM_006761.4         ATGATTCGGGAATATCGGCAAATGGTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATT
                    ************************************************************

HsCD00005018        CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
XM_005256784.1      CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
NM_006761.4         CTGGATGTACTGGACAAACACCTCATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTC
                    ************************************************************

HsCD00005018        TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
XM_005256784.1      TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
NM_006761.4         TATTATAAAATGAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGAC
                    ************************************************************

HsCD00005018        AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
XM_005256784.1      AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
NM_006761.4         AGGAAGGAGGCTGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATG
                    ************************************************************

HsCD00005018        ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
XM_005256784.1      ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
NM_006761.4         ACAGAACTTCCACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTC
                    ************************************************************

HsCD00005018        TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
XM_005256784.1      TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
NM_006761.4         TACTACGAAATTCTTAATTCCCCTGACCGTGCCTGCAGGTTGGCAAAAGCAGCTTTTGAT
                    ************************************************************

HsCD00005018        GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
XM_005256784.1      GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
NM_006761.4         GATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAGCTATAAGGACTCTACACTTATC
                    ************************************************************

HsCD00005018        ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
XM_005256784.1      ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGATTCC
NM_006761.4         ATGCAGTTGTTACGTGATAATCTGACACTATGGACTTCAGACATGCAGGGTGACGGTGAA
                    *******************************************************.* ..

HsCD00005018        GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTTG
XM_005256784.1      TAA---------------------------------------------
NM_006761.4         GAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGA
                     *.                                             

Pathways

NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : IGF1 pathway
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : PDGFR-beta signaling pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class II
NCI : TGF-beta receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
NCI : p75(NTR)-mediated signaling
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Apoptosis
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Centrosome maturation
Reactome : G2/M Transition
Reactome : HSF1 activation
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : Membrane Trafficking
Reactome : Mitotic G2-G2/M phases
Reactome : NADE modulates death signalling
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Signal Transduction
Reactome : Signaling by Hippo
Reactome : Signalling by NGF
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : P62258
HPRD : 05457

Clone

Cloning Information : 18704
HIP Master Clone ID : 32903
Original Clone ID : FLH018704.01L

Organism


TAX_ID : 9606
Species Specific ID: 7531

Genome

Chromosome : 17
Map Location : 17p13.3
Ensembl : ENSG00000108953