DNASU Plasmid Repository • 480.965.5697 | Email

RPS27A (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPS27A
Gene Name:  ribosomal protein S27a
Sequence             
Original Clone ID: ccsbBroadEn_01463
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC001392.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00506310

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 469nts         Open reading frame : 1 to 469
Reference Sequence Alignment

ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCG
GATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAG
CAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAAT
ATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGG
AAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG
GCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAG
TGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTAT
TGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPS27A
Symbol Nomenclature : RPS27A
SYNONYM : CEP80; HEL112; S27A; UBA80; UBC; UBCEP1; UBCEP80
Designation : 40S ribosomal protein S27a|epididymis luminal protein 112|ubiquitin C|ubiquitin and ribosomal protein S27a|ubiquitin carboxyl extension protein 80|ubiquitin-40S ribosomal protein S27a|ubiquitin-CEP80
Full Nomenclature : ribosomal protein S27a
GENEID : 6233
GenBank Accession : HQ448720
HGNC : 10417
MIM : 191343
Vega : OTTHUMG00000151919
Target GenBank: HQ448720

 

Reference Sequence Alignment

  

HsCD00506310        ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCG
NM_001135592.2      ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCG
NM_002954.5         ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCG
NM_001177413.1      ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCG
                    ************************************************************

HsCD00506310        GATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAG
NM_001135592.2      GATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAG
NM_002954.5         GATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAG
NM_001177413.1      GATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAG
                    ************************************************************

HsCD00506310        CAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAAT
NM_001135592.2      CAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAAT
NM_002954.5         CAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAAT
NM_001177413.1      CAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAAT
                    ************************************************************

HsCD00506310        ATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGG
NM_001135592.2      ATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGG
NM_002954.5         ATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGG
NM_001177413.1      ATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGG
                    ************************************************************

HsCD00506310        AAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG
NM_001135592.2      AAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG
NM_002954.5         AAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG
NM_001177413.1      AAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG
                    ************************************************************

HsCD00506310        GCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAG
NM_001135592.2      GCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAG
NM_002954.5         GCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAG
NM_001177413.1      GCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAG
                    ************************************************************

HsCD00506310        TGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTAT
NM_001135592.2      TGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTAT
NM_002954.5         TGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTAT
NM_001177413.1      TGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTAT
                    ************************************************************

HsCD00506310        TGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAG---
NM_001135592.2      TGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAA
NM_002954.5         TGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAA
NM_001177413.1      TGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAA
                    ************************************************   

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Cyclin B
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activated NOTCH1 Transmits Signal to the Nucleus
Reactome : Activated TLR4 signalling
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Activation of NF-kappaB in B cells
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Apoptosis
Reactome : Assembly Of The HIV Virion
Reactome : Assembly of the pre-replicative complex
Reactome : Association of licensing factors with the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Budding and maturation of HIV virion
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cap-dependent Translation Initiation
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cellular Senescence
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Constitutive Signaling by NOTCH1 HD Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downregulation of ERBB4 signaling
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : EGFR downregulation
Reactome : ER-Phagosome pathway
Reactome : Endosomal Sorting Complex Required For Transport (ESCRT)
Reactome : Eukaryotic Translation Elongation
Reactome : Eukaryotic Translation Initiation
Reactome : Eukaryotic Translation Termination
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Fanconi Anemia pathway
Reactome : Formation of a pool of free 40S subunits
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : G1 Phase
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Glycogen synthesis
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : Host Interactions of HIV factors
Reactome : IKK complex recruitment mediated by RIP1
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Ion channel transport
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Late Phase of HIV Life Cycle
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Membrane Trafficking
Reactome : Membrane binding and targetting of GAG proteins
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of mRNA
Reactome : Metabolism of proteins
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myoclonic epilepsy of Lafora
Reactome : NF-kB is activated and signals survival
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : NOTCH2 Activation and Transmission of Signal to the Nucleus
Reactome : NRIF signals cell death from the nucleus
Reactome : Negative regulation of FGFR signaling
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
Reactome : Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)
Reactome : Nonsense-Mediated Decay (NMD)
Reactome : Oncogene Induced Senescence
Reactome : Orc1 removal from chromatin
Reactome : Oxidative Stress Induced Senescence
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : PCP/CE pathway
Reactome : Peptide chain elongation
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Receptor-ligand binding initiates the second proteolytic cleavage of Notch receptor
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Removal of licensing factors from origins
Reactome : Ribosomal scanning and start codon recognition
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : SRP-dependent cotranslational protein targeting to membrane
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by NOTCH2
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Spry regulation of FGF signaling
Reactome : Stabilization of p53
Reactome : Stimuli-sensing channels
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
Reactome : Translation
Reactome : Translation initiation complex formation
Reactome : Transmembrane transport of small molecules
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Viral mRNA Translation
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
Reactome : regulation of FZD by ubiquitination
WikiPathway : Cytoplasmic Ribosomal Proteins

Protein

SMART domain : UBQ : Ubiquitin homologues
HPRD : 01878

Clone

Cloning Information : 667654
Original Clone ID : ccsbBroadEn_01463

Organism


TAX_ID : 9606
Species Specific ID: 6233

Genome

Chromosome : 2
Map Location : 2p16
Ensembl : ENSG00000143947

Reagents

Labome : RPS27A-antibody