DNASU Plasmid Repository • 480.965.5697 | Email

BID (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BID
Gene Name:  BH3 interacting domain death agonist
Sequence             
Original Clone ID: ccsbBroadEn_00161
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC022072.1
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Harvard Medical School
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
The ORFeome Collaboration
HsCD00506871

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 586nts        
Open reading frame : 1 to 586
Reference Sequence Alignment

ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAGTGCATCACAAACCTACTG
GTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGCAGAGAGCTGGACGCACTG
GGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTACGATGAGCTGCAGACTGAT
GGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCAGATTCTGAAAGTCAAGAA
GACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGGGACAGCATGGACCGTAGC
ATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACCAGCCGGTCGGAG
GAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAGGCCTACCCTAGA
GACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCC
AGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACAGTGAATTTTATTAACCAG
AACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATGGAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
1 error
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BID
Symbol Nomenclature : BID
SYNONYM : FP497
Designation : BH3-interacting domain death agonist|BID isoform ES(1b)|BID isoform L(2)|BID isoform Si6|Human BID coding sequence|apoptic death agonist|desmocollin type 4|p22 BID
Full Nomenclature : BH3 interacting domain death agonist
GENEID : 637
GenBank Accession : EU446512
HGNC : 1050
MIM : 601997
Vega : OTTHUMG00000150087
Target GenBank: EU446512

 

Reference Sequence Alignment

  

HsCD00506871        ------------------------------------------------------------
NM_001244567.1      ------------------------------------------------------------
NM_001196.3         ------------------------------------------------------------
NM_197966.2         ATGTGCAGCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGGGCCGGGCCGGCTGG
                                                                                

HsCD00506871        ------------------------------------------------------------
NM_001244567.1      ------------------------------------------------------------
NM_001196.3         ------------------------------------------------------------
NM_197966.2         AGGAGCACAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAGGAGTGAGTCGGAGC
                                                                                

HsCD00506871        ------------------ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_001244567.1      ------------------ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_001196.3         ------------------ATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
NM_197966.2         TGCCGCGCTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAG
                                      ******************************************

HsCD00506871        TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_001244567.1      TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_001196.3         TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
NM_197966.2         TGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGC
                    ************************************************************

HsCD00506871        AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_001244567.1      AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_001196.3         AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
NM_197966.2         AGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTAC
                    ************************************************************

HsCD00506871        GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_001244567.1      GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_001196.3         GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
NM_197966.2         GATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGAATAGAGGCA
                    ************************************************************

HsCD00506871        GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_001244567.1      GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_001196.3         GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
NM_197966.2         GATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCCCAGGTCGGG
                    ************************************************************

HsCD00506871        GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_001244567.1      GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_001196.3         GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
NM_197966.2         GACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGG
                    ************************************************************

HsCD00506871        AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_001244567.1      AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_001196.3         AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
NM_197966.2         AACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTG
                    ************************************************************

HsCD00506871        CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_001244567.1      CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_001196.3         CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
NM_197966.2         CTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTG
                    ************************************************************

HsCD00506871        CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_001244567.1      CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_001196.3         CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
NM_197966.2         CTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACA
                    ************************************************************

HsCD00506871        GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_001244567.1      GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_001196.3         GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
NM_197966.2         GTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATG
                    ************************************************************

HsCD00506871        GAC---
NM_001244567.1      GACTGA
NM_001196.3         GACTGA
NM_197966.2         GACTGA
                    ***   

Pathways

NCI : ATM pathway
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : Direct p53 effectors
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
Reactome : Activation and oligomerization of BAK protein
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Activation, myristolyation of BID and translocation to mitochondria
Reactome : Activation, translocation and oligomerization of BAX
Reactome : Apoptosis
Reactome : BH3-only proteins associate with and inactivate anti-apoptotic BCL-2 members
Reactome : Intrinsic Pathway for Apoptosis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TP53 network

Protein

HPRD : 03590

Clone

Cloning Information : 615658
Original Clone ID : ccsbBroadEn_00161

Organism


TAX_ID : 9606
Species Specific ID: 637

Genome

Chromosome : 22
Map Location : 22q11.1
Ensembl : ENSG00000015475

Reagents

Labome : Bid-antibody