DNASU Plasmid Repository • 480.965.5697 | Email

EGFR (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EGFR
Gene Name:  epidermal growth factor receptor
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH031257.01X
Keyword: short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00005097

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1218nts         Open reading frame : 1 to 1218
Reference Sequence Alignment

ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATTTTTCCTTCTTAAAG
ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAATGTGGAG
AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
ATCACAGGTTTGAGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1462
Start on reference sequence 245
Mutations:
None
Discrepancy:
c226t,L76F
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EGFR
Symbol Nomenclature : EGFR
SYNONYM : ERBB; ERBB1; HER1; PIG61; mENA
Designation : avian erythroblastic leukemia viral (v-erb-b) oncogene homolog|cell growth inhibiting protein 40|cell proliferation-inducing protein 61|proto-oncogene c-ErbB-1|receptor tyrosine-protein kinase erbB-1
Full Nomenclature : epidermal growth factor receptor
GENEID : 1956
GI : 61363298
GenBank Accession : AY890425
HGNC : 3236
MIM : 131550
Vega : OTTHUMG00000023661
Target GenBank: U48722

 

Reference Sequence Alignment

  

HsCD00005097      ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
NM_201284.1       ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
NM_005228.3       ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
NM_201282.1       ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
NM_201283.1       ATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCG
                  ************************************************************

HsCD00005097      GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
NM_201284.1       GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
NM_005228.3       GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
NM_201282.1       GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
NM_201283.1       GCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAG
                  ************************************************************

HsCD00005097      TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
NM_201284.1       TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
NM_005228.3       TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
NM_201282.1       TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
NM_201283.1       TTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTG
                  ************************************************************

HsCD00005097      GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATTTTTCCTTCTTAAAG
NM_201284.1       GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAG
NM_005228.3       GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAG
NM_201282.1       GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAG
NM_201283.1       GTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAG
                  ********************************************* **************

HsCD00005097      ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
NM_201284.1       ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
NM_005228.3       ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
NM_201282.1       ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
NM_201283.1       ACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCT
                  ************************************************************

HsCD00005097      TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
NM_201284.1       TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
NM_005228.3       TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
NM_201282.1       TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
NM_201283.1       TTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCA
                  ************************************************************

HsCD00005097      GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
NM_201284.1       GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
NM_005228.3       GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
NM_201282.1       GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
NM_201283.1       GTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTA
                  ************************************************************

HsCD00005097      CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAATGTGGAG
NM_201284.1       CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAG
NM_005228.3       CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAG
NM_201282.1       CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAG
NM_201283.1       CAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAG
                  ***************************************************** ******

HsCD00005097      AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
NM_201284.1       AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
NM_005228.3       AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
NM_201282.1       AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
NM_201283.1       AGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTC
                  ************************************************************

HsCD00005097      CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
NM_201284.1       CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
NM_005228.3       CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
NM_201282.1       CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
NM_201283.1       CAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGG
                  ************************************************************

HsCD00005097      GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
NM_201284.1       GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
NM_005228.3       GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
NM_201282.1       GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
NM_201283.1       GGTGCAGGAGAGGAGAACTGCCAGAAACTGACCAAAATCATCTGTGCCCAGCAGTGCTCC
                  ************************************************************

HsCD00005097      GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
NM_201284.1       GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
NM_005228.3       GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
NM_201282.1       GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
NM_201283.1       GGGCGCTGCCGTGGCAAGTCCCCCAGTGACTGCTGCCACAACCAGTGTGCTGCAGGCTGC
                  ************************************************************

HsCD00005097      ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
NM_201284.1       ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
NM_005228.3       ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
NM_201282.1       ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
NM_201283.1       ACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGC
                  ************************************************************

HsCD00005097      AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
NM_201284.1       AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
NM_005228.3       AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
NM_201282.1       AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
NM_201283.1       AAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAAC
                  ************************************************************

HsCD00005097      CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
NM_201284.1       CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
NM_005228.3       CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
NM_201282.1       CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
NM_201283.1       CCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTG
                  ************************************************************

HsCD00005097      GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
NM_201284.1       GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
NM_005228.3       GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
NM_201282.1       GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
NM_201283.1       GTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAGGAA
                  ************************************************************

HsCD00005097      GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
NM_201284.1       GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
NM_005228.3       GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
NM_201282.1       GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
NM_201283.1       GACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGTGTGTAACGGAATA
                  ************************************************************

HsCD00005097      GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
NM_201284.1       GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
NM_005228.3       GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
NM_201282.1       GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
NM_201283.1       GGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAA
                  ************************************************************

HsCD00005097      AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
NM_201284.1       AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
NM_005228.3       AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
NM_201282.1       AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
NM_201283.1       AACTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGTGACTCC
                  ************************************************************

HsCD00005097      TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
NM_201284.1       TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
NM_005228.3       TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
NM_201282.1       TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
NM_201283.1       TTCACACATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAA
                  ************************************************************

HsCD00005097      ATCACAGGTTTGAGCTAG------------------------------------------
NM_201284.1       ATCACAGGGTTTTTGCTGATTCAGGCTTGGCCTGAAAACAGGACGGACCTCCATGCCTTT
NM_005228.3       ATCACAGGGTTTTTGCTGATTCAGGCTTGGCCTGAAAACAGGACGGACCTCCATGCCTTT
NM_201282.1       ATCACAGGGTTTTTGCTGATTCAGGCTTGGCCTGAAAACAGGACGGACCTCCATGCCTTT
NM_201283.1       ATCACAGGTTTGAGCTGA------------------------------------------
                  ******** ** :    .                                          

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GAGAACCTAGAAATCATACGCGGCAGGACCAAGCAACATGGTCAGTTTTCTCTTGCAGTC
NM_005228.3       GAGAACCTAGAAATCATACGCGGCAGGACCAAGCAACATGGTCAGTTTTCTCTTGCAGTC
NM_201282.1       GAGAACCTAGAAATCATACGCGGCAGGACCAAGCAACATGGTCAGTTTTCTCTTGCAGTC
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GTCAGCCTGAACATAACATCCTTGGGATTACGCTCCCTCAAGGAGATAAGTGATGGAGAT
NM_005228.3       GTCAGCCTGAACATAACATCCTTGGGATTACGCTCCCTCAAGGAGATAAGTGATGGAGAT
NM_201282.1       GTCAGCCTGAACATAACATCCTTGGGATTACGCTCCCTCAAGGAGATAAGTGATGGAGAT
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GTGATAATTTCAGGAAACAAAAATTTGTGCTATGCAAATACAATAAACTGGAAAAAACTG
NM_005228.3       GTGATAATTTCAGGAAACAAAAATTTGTGCTATGCAAATACAATAAACTGGAAAAAACTG
NM_201282.1       GTGATAATTTCAGGAAACAAAAATTTGTGCTATGCAAATACAATAAACTGGAAAAAACTG
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       TTTGGGACCTCCGGTCAGAAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAAG
NM_005228.3       TTTGGGACCTCCGGTCAGAAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAAG
NM_201282.1       TTTGGGACCTCCGGTCAGAAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAAG
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GCCACAGGCCAGGTCTGCCATGCCTTGTGCTCCCCCGAGGGCTGCTGGGGCCCGGAGCCC
NM_005228.3       GCCACAGGCCAGGTCTGCCATGCCTTGTGCTCCCCCGAGGGCTGCTGGGGCCCGGAGCCC
NM_201282.1       GCCACAGGCCAGGTCTGCCATGCCTTGTGCTCCCCCGAGGGCTGCTGGGGCCCGGAGCCC
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       AGGGACTGCGTCTCTTGCCGGAATGTCAGCCGAGGCAGGGAATGCGTGGACAAGTGCAAC
NM_005228.3       AGGGACTGCGTCTCTTGCCGGAATGTCAGCCGAGGCAGGGAATGCGTGGACAAGTGCAAC
NM_201282.1       AGGGACTGCGTCTCTTGCCGGAATGTCAGCCGAGGCAGGGAATGCGTGGACAAGTGCAAC
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       CTTCTGGAGGGTGAGCCAAGGGAGTTTGTGGAGAACTCTGAGTGCATACAGTGCCACCCA
NM_005228.3       CTTCTGGAGGGTGAGCCAAGGGAGTTTGTGGAGAACTCTGAGTGCATACAGTGCCACCCA
NM_201282.1       CTTCTGGAGGGTGAGCCAAGGGAGTTTGTGGAGAACTCTGAGTGCATACAGTGCCACCCA
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GAGTGCCTGCCTCAGGCCATGAACATCACCTGCACAGGACGGGGACCAGACAACTGTATC
NM_005228.3       GAGTGCCTGCCTCAGGCCATGAACATCACCTGCACAGGACGGGGACCAGACAACTGTATC
NM_201282.1       GAGTGCCTGCCTCAGGCCATGAACATCACCTGCACAGGACGGGGACCAGACAACTGTATC
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       CAGTGTGCCCACTACATTGACGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATG
NM_005228.3       CAGTGTGCCCACTACATTGACGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATG
NM_201282.1       CAGTGTGCCCACTACATTGACGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATG
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGC
NM_005228.3       GGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGC
NM_201282.1       GGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGC
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       CATCCAAACTGCACCTACGGGCCAGGAAATGAGAGTCTCAAAG-----------------
NM_005228.3       CATCCAAACTGCACCTACGGATGCACTGGGCCAGGTCTTGAAGGCTGTCCAACGAATGGG
NM_201282.1       CATCCAAACTGCACCTACGGGTCCTAA---------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       CCTAAGATCCCGTCCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGCTGCTGGTGGTG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       -CCATGTTATTCTGCCTTTTTAAACTAT--------------------------------
NM_005228.3       GCCCTGGGGATCGGCCTCTTCATGCGAAGGCGCCACATCGTTCGGAAGCGCACGCTGCGG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       AGGCTGCTGCAGGAGAGGGAGCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAAC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------CATCCTGTAATCAAAGTAATGATG------------
NM_005228.3       CAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGGCTCC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ----------GCAGCGTGTCCCACCAGAGCGGGAGCCCAGCTGCTCAGGAG---------
NM_005228.3       GGTGCGTTCGGCACGGTGTATAAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATT
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       CCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       --TCATGCTTAGGATGGATCCCTTCTCTTCTGCCGTCAGAGTTTCAGCTGGGTTGGGGTG
NM_005228.3       GATGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       GATGCAGCCACCTCCATGCCTGGCCTTCTGCATCTGTGATCATCACGGCCTCCTCCTGCC
NM_005228.3       TGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGAC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ACTGA-------------------------------------------------------
NM_005228.3       TATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTGTGTGCAG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       ATCGCAAAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       AGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAA
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       CTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTGCCTATCAAGTGG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       ATGGCATTGGAATCAATTTTACACAGAATCTATACCCACCAGAGTGATGTCTGGAGCTAC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       GGGGTGACCGTTTGGGAGTTGATGACCTTTGGATCCAAGCCATATGACGGAATCCCTGCC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       AGCGAGATCTCCTCCATCCTGGAGAAAGGAGAACGCCTCCCTCAGCCACCCATATGTACC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       ATCGATGTCTACATGATCATGGTCAAGTGCTGGATGATAGACGCAGATAGTCGCCCAAAG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       TTCCGTGAGTTGATCATCGAATTCTCCAAAATGGCCCGAGACCCCCAGCGCTACCTTGTC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       ATTCAGGGGGATGAAAGAATGCATTTGCCAAGTCCTACAGACTCCAACTTCTACCGTGCC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       CTGATGGATGAAGAAGACATGGACGACGTGGTGGATGCCGACGAGTACCTCATCCCACAG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       CAGGGCTTCTTCAGCAGCCCCTCCACGTCACGGACTCCCCTCCTGAGCTCTCTGAGTGCA
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       ACCAGCAACAATTCCACCGTGGCTTGCATTGATAGAAATGGGCTGCAAAGCTGTCCCATC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       AAGGAAGACAGCTTCTTGCAGCGATACAGCTCAGACCCCACAGGCGCCTTGACTGAGGAC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       AGCATAGACGACACCTTCCTCCCAGTGCCTGAATACATAAACCAGTCCGTTCCCAAAAGG
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       CCCGCTGGCTCTGTGCAGAATCCTGTCTATCACAATCAGCCTCTGAACCCCGCGCCCAGC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       AGAGACCCACACTACCAGGACCCCCACAGCACTGCAGTGGGCAACCCCGAGTATCTCAAC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       ACTGTCCAGCCCACCTGTGTCAACAGCACATTCGACAGCCCTGCCCACTGGGCCCAGAAA
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       GGCAGCCACCAAATTAGCCTGGACAACCCTGACTACCAGCAGGACTTCTTTCCCAAGGAA
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_005228.3       GCCAAGCCAAATGGCATCTTTAAGGGCTCCACAGCTGAAAATGCAGAATACCTAAGGGTC
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------
                                                                              

HsCD00005097      ---------------------------------
NM_201284.1       ---------------------------------
NM_005228.3       GCGCCACAAAGCAGTGAATTTATTGGAGCATGA
NM_201282.1       ---------------------------------
NM_201283.1       ---------------------------------
                                                   

Pathways

NCI : Arf6 signaling events
NCI : Direct p53 effectors
NCI : E-cadherin signaling in keratinocytes
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EGFR-dependent Endothelin signaling events
NCI : ErbB receptor signaling network
NCI : ErbB1 downstream signaling
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Regulation of Telomerase
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
NCI : Stabilization and expansion of the E-cadherin adherens junction
NCI : Syndecan-3-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : a6b1 and a6b4 Integrin signaling
Panther : Cadherin signaling pathway
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : EGFR downregulation
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : L1CAM interactions
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Androgen receptor signaling pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of Actin Cytoskeleton

Protein

SMART domain : FU : Furin-like repeats
UniProt : P00533
HPRD : 00579

Clone

Cloning Information : 31257
HIP Master Clone ID : 61633
Original Clone ID : FLH031257.01X

Organism


TAX_ID : 9606
Species Specific ID: 1956

Genome

Chromosome : 7
Map Location : 7p12
Ensembl : ENSG00000146648

Reagents

Labome : EGFR-antibody