DNASU Plasmid Repository • 480.965.5697 | Email

FAS (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FAS
Gene Name:  Fas cell surface death receptor
Sequence             
Original Clone ID: ccsbBroadEn_00087
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC012479.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00510020

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1006nts         Open reading frame : 1 to 1006
Reference Sequence Alignment

ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT
CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA
AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACCTTAAATCCTGAAACAGTG
GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FAS
Symbol Nomenclature : FAS
SYNONYM : ALPS1A; APO-1; APT1; CD95; FAS1; FASTM; TNFRSF6
Designation : APO-1 cell surface antigen|CD95 antigen|Delta Fas/APO-1/CD95|FAS 827dupA|FAS receptor variant 9|FASLG receptor|Fas (TNF receptor superfamily, member 6)|Fas AMA|TNF receptor superfamily member 6|apoptosis antigen 1|apoptosis-mediating surface antigen FAS|tumor necrosis factor receptor superfamily member 6|tumor necrosis factor receptor superfamily, member 6
Full Nomenclature : Fas cell surface death receptor
GENEID : 355
Locus Tag : RP11-399O19.7
GenBank Accession : DQ894675
HGNC : 11920
MIM : 134637
Vega : OTTHUMG00000018701
Target GenBank: DQ894675

 

Reference Sequence Alignment

  

HsCD00510020      ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
NM_000043.4       ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
NM_152871.2       ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
                  ************************************************************

HsCD00510020      AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
NM_000043.4       AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
NM_152871.2       AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
                  ************************************************************

HsCD00510020      GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
NM_000043.4       GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
NM_152871.2       GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
                  ************************************************************

HsCD00510020      AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
NM_000043.4       AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
NM_152871.2       AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
                  ************************************************************

HsCD00510020      GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
NM_000043.4       GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
NM_152871.2       GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
                  ************************************************************

HsCD00510020      TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
NM_000043.4       TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
NM_152871.2       TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
                  ************************************************************

HsCD00510020      CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
NM_000043.4       CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
NM_152871.2       CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
                  ************************************************************

HsCD00510020      GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
NM_000043.4       GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
NM_152871.2       GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
                  ************************************************************

HsCD00510020      AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT
NM_000043.4       AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT
NM_152871.2       AGCAACACCAAGTGCAAAGAGGAAG-----------------------------------
                  *************************                                   

HsCD00510020      CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA
NM_000043.4       CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA
NM_152871.2       ----------------------------TGAAGAGAAAGGAAGTACAGAAAACATGCAGA
                                              ********************************

HsCD00510020      AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACCTTAAATCCTGAAACAGTG
NM_000043.4       AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACTTTAAATCCTGAAACAGTG
NM_152871.2       AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACTTTAAATCCTGAAACAGTG
                  ***************************************** ******************

HsCD00510020      GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
NM_000043.4       GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
NM_152871.2       GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
                  ************************************************************

HsCD00510020      ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
NM_000043.4       ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
NM_152871.2       ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
                  ************************************************************

HsCD00510020      GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
NM_000043.4       GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
NM_152871.2       GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
                  ************************************************************

HsCD00510020      TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
NM_000043.4       TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
NM_152871.2       TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
                  ************************************************************

HsCD00510020      GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
NM_000043.4       GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
NM_152871.2       GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
                  ************************************************************

HsCD00510020      GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTC---
NM_000043.4       GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTAG
NM_152871.2       GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTAG
                  *********************************************   

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Direct p53 effectors
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : p73 transcription factor network
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Panther : p53 pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : FasL/ CD95L signaling
Reactome : Regulation by c-FLIP
WikiPathway : Adipogenesis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : MAPK signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 608921
Original Clone ID : ccsbBroadEn_00087

Organism


TAX_ID : 9606
Species Specific ID: 355

Genome

Chromosome : 10
Map Location : 10q24.1
Ensembl : ENSG00000026103

Reagents

Labome : Fas-antibody