DNASU Plasmid Repository • 480.965.5697 | Email

RAF1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAF1
Gene Name:  v-raf-1 murine leukemia viral oncogene homolog 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127857.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00005106

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1947nts         Open reading frame : 1 to 1947
Reference Sequence Alignment

ATGGAGCACATACAGGGAGCTTGGAAGACGATCAGCAATGGTTTTGGATTCAAAGATGCC
GTGTTTGATGGCTCCAGCTGCATCTCTCCTACAATAGTTCAGCAGTTTGGCTATCAGCGC
CGGGCATCAGATGATGGCAAACTCACAGATCCTTCTAAGACAAGCAACACTATCCGTGTT
TTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGAC
TGCCTTATGAAAGCACTCAAGGTGAGGGGCCTGCAACCAGAGTGCTGTGCAGTGTTCAGA
CTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCT
TTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAAC
TTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTC
AATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTA
CCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTATTGTTTCCAAATTCCACT
ATTGGTGATAGTGGAGTCCCAGCACTACCTTCTTTGACTATGCGTCGTATGCGAGAGTCT
GTTTCCAGGATGCCTGTTAGTTCTCAGCACAGATATTCTACACCTCACGCCTTCACCTTT
AACACCTCCAGTCCCTCATCTGAAGGTTCCCTCTCCCAGAGGCAGAGGTCGACATCCACA
CCTAATGTCCACATGGTCAGCACCACCCTGCCTGTGGACAGCAGGATGATTGAGGATGCA
ATTCGAAGTCACAGCGAATCAGCCTCACCTTCAGCCCTGTCCAGTAGCCCCAACAATCTG
AGCCCAACAGGCTGGTCACAGCCGAAAACCCCCGTGCCAGCACAAAGAGAGCGGGCACCA
GTATCTGGGACCCAGGAGAAAAACAAAATTAGGCCTCGTGGACAGAGAGATTCAAGCTAT
TATTGGGAAATAGAAGCCAGTGAAGTGATGCTGTCCACTCGGATTGGGTCAGGCTCTTTT
GGAACTGTTTATAAGGGTAAATGGCACGGAGATGTTGCAGTAAAGATCCTAAAGGTTGTC
GACCCAACCCCAGAGCAATTCCAGGCCTTCAGGAATGAGGTGGCTGTTCTGCGCAAAACA
CGGCATGTGAACATTCTGCTTTTCATGGGGTACATGACAAAGGACAACCTGGCAATTGTG
ACCCAGTGGTGCGAGGGCAGCAGCCTCTACAAACACCTGCATGTCCAGGAGACCAAGTTT
CAGATGTTCCAGCTAATTGACATTGCCCGGCAGACGGCTCAGGGAATGGACTATTTGCAT
GCAAAGAACATCATCCATAGAGACATGAAATCCAACAATATATTTCTCCATGAAGGCTTA
ACAGTGAAAATTGGAGATTTTGGTTTGGCAACAGTAAAGTCACGCTGGAGTGGTTCTCAG
CAGGTTGAACAACCTACTGGCTCTGTCCTCTGGATGGCCCCAGAGGTGATCCGAATGCAG
GATAACAACCCATTCAGTTTCCAGTCGGATGTCTACTCCTATGGCATCGTATTGTATGAA
CTGATGACGGGGGAGCTTCCTTATTCTCACATCAACAACCGAGATCAGATCATCTTCATG
GTGGGCCGAGGATATGCCTCCCCAGATCTTAGTAAGCTATATAAGAACTGCCCCAAAGCA
ATGAAGAGGCTGGTAGCTGACTGTGTGAAGAAAGTAAAGGAAGAGAGGCCTCTTTTTCCC
CAGATCCTGTCTTCCATTGAGCTGCTCCAACACTCTCTACCGAAGATCAACCGGAGCGCT
TCCGAGCCATCCTTGCATCGGGCAGCCCACACTGAGGATATCAATGCTTGCACGCTGACC
ACGTCCCCGAGGCTGCCTGTCTTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2076
Start on reference sequence 130
Mutations:
None
Discrepancy:
g807c
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAF1
Symbol Nomenclature : RAF1
SYNONYM : CRAF; NS5; Raf-1; c-Raf
Designation : Oncogene RAF1|RAF proto-oncogene serine/threonine-protein kinase|proto-oncogene c-RAF|raf proto-oncogene serine/threonine protein kinase
Full Nomenclature : v-raf-1 murine leukemia viral oncogene homolog 1
GENEID : 5894
GI : 60820533
GenBank Accession : AY893502
HGNC : 9829
MIM : 164760
Vega : OTTHUMG00000129789
Target GenBank: X03484

 

Reference Sequence Alignment

  

HsCD00005106        ATGGAGCACATACAGGGAGCTTGGAAGACGATCAGCAATGGTTTTGGATTCAAAGATGCC
XM_005265355.1      ATGGAGCACATACAGGGAGCTTGGAAGACGATCAGCAATGGTTTTGGATTCAAAGATGCC
NM_002880.3         ATGGAGCACATACAGGGAGCTTGGAAGACGATCAGCAATGGTTTTGGATTCAAAGATGCC
XM_005265357.1      ATGGAGCACATACAGGGAGCTTGGAAGACGATCAGCAATGGTTTTGGATTCAAAGATGCC
                    ************************************************************

HsCD00005106        GTGTTTGATGGCTCCAGCTGCATCTCTCCTACAATAGTTCAGCAGTTTGGCTATCAGCGC
XM_005265355.1      GTGTTTGATGGCTCCAGCTGCATCTCTCCTACAATAGTTCAGCAGTTTGGCTATCAGCGC
NM_002880.3         GTGTTTGATGGCTCCAGCTGCATCTCTCCTACAATAGTTCAGCAGTTTGGCTATCAGCGC
XM_005265357.1      GTGTTTGATGGCTCCAGCTGCATCTCTCCTACAATAGTTCAGCAGTTTGGCTATCAGCGC
                    ************************************************************

HsCD00005106        CGGGCATCAGATGATGGCAAACTCACAGATCCTTCTAAGACAAGCAACACTATCCGTGTT
XM_005265355.1      CGGGCATCAGATGATGGCAAACTCACAGATCCTTCTAAGACAAGCAACACTATCCGTGTT
NM_002880.3         CGGGCATCAGATGATGGCAAACTCACAGATCCTTCTAAGACAAGCAACACTATCCGTGTT
XM_005265357.1      CGGGCATCAGATGATGGCAAACTCACAGATCCTTCTAAGACAAGCAACACTATCCGTGTT
                    ************************************************************

HsCD00005106        TTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGAC
XM_005265355.1      TTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGAC
NM_002880.3         TTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGAC
XM_005265357.1      TTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGAC
                    ************************************************************

HsCD00005106        TGCCTTATGAAAGCACTCAAGGTGAGGGGCCTGCAACCAGAGTGCTGTGCAGTGTTCAGA
XM_005265355.1      TGCCTTATGAAAGCACTCAAGGTGAGGGGCCTGCAACCAGAGTGCTGTGCAGTGTTCAGA
NM_002880.3         TGCCTTATGAAAGCACTCAAGGTGAGGGGCCTGCAACCAGAGTGCTGTGCAGTGTTCAGA
XM_005265357.1      TGCCTTATGAAAGCACTCAAGGTGAGGGGCCTGCAACCAGAGTGCTGTGCAGTGTTCAGA
                    ************************************************************

HsCD00005106        CTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCT
XM_005265355.1      CTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCT
NM_002880.3         CTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCT
XM_005265357.1      CTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCT
                    ************************************************************

HsCD00005106        TTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAAC
XM_005265355.1      TTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAAC
NM_002880.3         TTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAAC
XM_005265357.1      TTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAAC
                    ************************************************************

HsCD00005106        TTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTC
XM_005265355.1      TTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTC
NM_002880.3         TTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTC
XM_005265357.1      TTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTC
                    ************************************************************

HsCD00005106        AATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTA
XM_005265355.1      AATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTA
NM_002880.3         AATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTA
XM_005265357.1      AATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTA
                    ************************************************************

HsCD00005106        CCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTATTGTTTCCAAATTCCACT
XM_005265355.1      CCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTATTGTTTCCAAATTCCACT
NM_002880.3         CCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTATTGTTTCCAAATTCCACT
XM_005265357.1      CCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTTT-----------------
                    *****************************************:*                 

HsCD00005106        ATTGGTGATAGTGGAGTCCCAGCACTACCTTCTTTGACTATGCGTCGTATGCGAGAGTCT
XM_005265355.1      ATTGGTGATAGTGGAGTCCCAGCACTACCTTCTTTGACTATGCGTCGTATGCGAGAGTCT
NM_002880.3         ATTGGTGATAGTGGAGTCCCAGCACTACCTTCTTTGACTATGCGTCGTATGCGAGAGTCT
XM_005265357.1      ------------------------------------------------------------
                                                                                

HsCD00005106        GTTTCCAGGATGCCTGTTAGTTCTCAGCACAGATATTCTACACCTCACGCCTTCACCTTT
XM_005265355.1      GTTTCCAGGATGCCTGTTAGTTCTCAGCACAGATATTCTACACCTCACGCCTTCACCTTT
NM_002880.3         GTTTCCAGGATGCCTGTTAGTTCTCAGCACAGATATTCTACACCTCACGCCTTCACCTTT
XM_005265357.1      ----------------------CTCAGCACAGATATTCTACACCTCACGCCTTCACCTTT
                                          **************************************

HsCD00005106        AACACCTCCAGTCCCTCATCTGAAGGTTCCCTCTCCCAGAGGCAGAGGTCGACATCCACA
XM_005265355.1      AACACCTCCAGTCCCTCATCTGAAGGTTCCCTCTCCCAGAGGCAGAGGTCGACATCCACA
NM_002880.3         AACACCTCCAGTCCCTCATCTGAAGGTTCCCTCTCCCAGAGGCAGAGGTCGACATCCACA
XM_005265357.1      AACACCTCCAGTCCCTCATCTGAAGGTTCCCTCTCCCAGAGGCAGAGGTCGACATCCACA
                    ************************************************************

HsCD00005106        CCTAATGTCCACATGGTCAGCACCACCCTGCCTGTGGACAGCAGGATGATTGAGGATGCA
XM_005265355.1      CCTAATGTCCACATGGTCAGCACCACCCTGCCTGTGGACAGCAGGATGATTGAGGATGCA
NM_002880.3         CCTAATGTCCACATGGTCAGCACCACCCTGCCTGTGGACAGCAGGATGATTGAGGATGCA
XM_005265357.1      CCTAATGTCCACATGGTCAGCACCACCCTGCCTGTGGACAGCAGGATGATTGAGGATGCA
                    ************************************************************

HsCD00005106        ATTCGAAGTCACAGCGAATCAGCCTCACCTTCAGCCCTGTCCAGTAGCCCCAACAATCTG
XM_005265355.1      ATTCGAAGTCACAGCGAATCAGCCTCACCTTCAGCCCTGTCCAGTAGCCCCAACAATCTG
NM_002880.3         ATTCGAAGTCACAGCGAATCAGCCTCACCTTCAGCCCTGTCCAGTAGCCCCAACAATCTG
XM_005265357.1      ATTCGAAGTCACAGCGAATCAGCCTCACCTTCAGCCCTGTCCAGTAGCCCCAACAATCTG
                    ************************************************************

HsCD00005106        AGCCCAACAGGCTGGTCACAGCCGAAAACCCCCGTGCCAGCACAAAGAGAGCGGGCACCA
XM_005265355.1      AGCCCAACAGGCTGGTCACAGCCGAAAACCCCCGTGCCAGCACAAAGAGAGCGGGCACCA
NM_002880.3         AGCCCAACAGGCTGGTCACAGCCGAAAACCCCCGTGCCAGCACAAAGAGAGCGGGCACCA
XM_005265357.1      AGCCCAACAGGCTGGTCACAGCCGAAAACCCCCGTGCCAGCACAAAGAGAGCGGGCACCA
                    ************************************************************

HsCD00005106        GTATCTGGGACCCAGGAGAAAAACAAAATTAGGCCTCGTGGACAGAGAGATTCAAGCTAT
XM_005265355.1      GTATCTGGGACCCAGGAGAAAAACAAAATTAGGCCTCGTGGACAGAGAGATTCAAGCTAT
NM_002880.3         GTATCTGGGACCCAGGAGAAAAACAAAATTAGGCCTCGTGGACAGAGAGATTCAAGCTAT
XM_005265357.1      GTATCTGGGACCCAGGAGAAAAACAAAATTAGGCCTCGTGGACAGAGAGATTCAAGCTAT
                    ************************************************************

HsCD00005106        TATTGGGAAATAGAAGCCAGTGAAGTGATGCTGTCCACTCGGATTGGGTCAGGCTCTTTT
XM_005265355.1      TATTGGGAAATAGAAGCCAGTGAAGTGATGCTGTCCACTCGGATTGGGTCAGGCTCTTTT
NM_002880.3         TATTGGGAAATAGAAGCCAGTGAAGTGATGCTGTCCACTCGGATTGGGTCAGGCTCTTTT
XM_005265357.1      TATTGGGAAATAGAAGCCAGTGAAGTGATGCTGTCCACTCGGATTGGGTCAGGCTCTTTT
                    ************************************************************

HsCD00005106        GGAACTGTTTATAAGGGTAAATGGCACGGAGATGTTGCAGTAAAGATCCTAAAGGTTGTC
XM_005265355.1      GGAACTGTTTATAAGGGTAAATGGCACGGAGATGTTGCAGTAAAGATCCTAAAGGTTGTC
NM_002880.3         GGAACTGTTTATAAGGGTAAATGGCACGGAGATGTTGCAGTAAAGATCCTAAAGGTTGTC
XM_005265357.1      GGAACTGTTTATAAGGGTAAATGGCACGGAGATGTTGCAGTAAAGATCCTAAAGGTTGTC
                    ************************************************************

HsCD00005106        GACCCAACCCCAGAGCAATTCCAGGCCTTCAGGAATGAGGTGGCTGTTCTGCGCAAAACA
XM_005265355.1      GACCCAACCCCAGAGCAATTCCAGGCCTTCAGGAATGAGGTGGCTGTTCTGCGCAAAACA
NM_002880.3         GACCCAACCCCAGAGCAATTCCAGGCCTTCAGGAATGAGGTGGCTGTTCTGCGCAAAACA
XM_005265357.1      GACCCAACCCCAGAGCAATTCCAGGCCTTCAGGAATGAGGTGGCTGTTCTGCGCAAAACA
                    ************************************************************

HsCD00005106        CGGCATGTGAACATTCTGCTTTTCATGGGGTACATGACAAAGGACAACCTGGCAATTGTG
XM_005265355.1      CGGCATGTGAACATTCTGCTTTTCATGGGGTACATGACAAAGGACAACCTGGCAATTGTG
NM_002880.3         CGGCATGTGAACATTCTGCTTTTCATGGGGTACATGACAAAGGACAACCTGGCAATTGTG
XM_005265357.1      CGGCATGTGAACATTCTGCTTTTCATGGGGTACATGACAAAGGACAACCTGGCAATTGTG
                    ************************************************************

HsCD00005106        ACCCAGTGGTGCGAGGGCAGCAGCCTCTACAAACACCTGCATGTCCAGGAGACCAAGTTT
XM_005265355.1      ACCCAGTGGTGCGAGGGCAGCAGCCTCTACAAACACCTGCATGTCCAGGAGACCAAGTTT
NM_002880.3         ACCCAGTGGTGCGAGGGCAGCAGCCTCTACAAACACCTGCATGTCCAGGAGACCAAGTTT
XM_005265357.1      ACCCAGTGGTGCGAGGGCAGCAGCCTCTACAAACACCTGCATGTCCAGGAGACCAAGTTT
                    ************************************************************

HsCD00005106        CAGATGTTCCAGCTAATTGACATTGCCCGGCAGACGGCTCAGGGAATGGACTATTTGCAT
XM_005265355.1      CAGATGTTCCAGCTAATTGACATTGCCCGGCAGACGGCTCAGGGAATGGACTATTTGCAT
NM_002880.3         CAGATGTTCCAGCTAATTGACATTGCCCGGCAGACGGCTCAGGGAATGGACTATTTGCAT
XM_005265357.1      CAGATGTTCCAGCTAATTGACATTGCCCGGCAGACGGCTCAGGGAATGGACTATTTGCAT
                    ************************************************************

HsCD00005106        GCAAAGAACATCATCCATAGAGACATGAAATCCAACAATATATTTCTCCATGAAGGCTTA
XM_005265355.1      GCAAAGAACATCATCCATAGAGACATGAAATCCAACAATATATTTCTCCATGAAGGCTTA
NM_002880.3         GCAAAGAACATCATCCATAGAGACATGAAATCCAACAATATATTTCTCCATGAAGGCTTA
XM_005265357.1      GCAAAGAACATCATCCATAGAGACATGAAATCCAACAATATATTTCTCCATGAAGGCTTA
                    ************************************************************

HsCD00005106        ACAGTGAAAATTGGAGATTTTGGTTTGGCAACAGTAAAGTCACGCTGGAGTGGTTCTCAG
XM_005265355.1      ACAGTGAAAATTGGAGATTTTGGTTTGGCAACAGTAAAGTCACGCTGGAGTGGTTCTCAG
NM_002880.3         ACAGTGAAAATTGGAGATTTTGGTTTGGCAACAGTAAAGTCACGCTGGAGTGGTTCTCAG
XM_005265357.1      ACAGTGAAAATTGGAGATTTTGGTTTGGCAACAGTAAAGTCACGCTGGAGTGGTTCTCAG
                    ************************************************************

HsCD00005106        CAGGTTGAACAACCTACTGGCTCTGTCCTCTGGATGGCCCCAGAGGTGATCCGAATGCAG
XM_005265355.1      CAGGTTGAACAACCTACTGGCTCTGTCCTCTGGATGGCCCCAGAGGTGATCCGAATGCAG
NM_002880.3         CAGGTTGAACAACCTACTGGCTCTGTCCTCTGGATGGCCCCAGAGGTGATCCGAATGCAG
XM_005265357.1      CAGGTTGAACAACCTACTGGCTCTGTCCTCTGGATGGCCCCAGAGGTGATCCGAATGCAG
                    ************************************************************

HsCD00005106        GATAACAACCCATTCAGTTTCCAGTCGGATGTCTACTCCTATGGCATCGTATTGTATGAA
XM_005265355.1      GATAACAACCCATTCAGTTTCCAGTCGGATGTCTACTCCTATGGCATCGTATTGTATGAA
NM_002880.3         GATAACAACCCATTCAGTTTCCAGTCGGATGTCTACTCCTATGGCATCGTATTGTATGAA
XM_005265357.1      GATAACAACCCATTCAGTTTCCAGTCGGATGTCTACTCCTATGGCATCGTATTGTATGAA
                    ************************************************************

HsCD00005106        CTGATGACGGGGGAGCTTCCTTATTCTCACATCAACAACCGAGATCAGATCATCTTCATG
XM_005265355.1      CTGATGACGGGGGAGCTTCCTTATTCTCACATCAACAACCGAGATCAGATCATCTTCATG
NM_002880.3         CTGATGACGGGGGAGCTTCCTTATTCTCACATCAACAACCGAGATCAGATCATCTTCATG
XM_005265357.1      CTGATGACGGGGGAGCTTCCTTATTCTCACATCAACAACCGAGATCAGATCATCTTCATG
                    ************************************************************

HsCD00005106        GTGGGCCGAGGATATGCCTCCCCAGATCTTAGTAAGCTATATAAGAACTGCCCCAAAGCA
XM_005265355.1      GTGGGCCGAGGATATGCCTCCCCAGATCTTAGTAAGCTATATAAGAACTGCCCCAAAGCA
NM_002880.3         GTGGGCCGAGGATATGCCTCCCCAGATCTTAGTAAGCTATATAAGAACTGCCCCAAAGCA
XM_005265357.1      GTGGGCCGAGGATATGCCTCCCCAGATCTTAGTAAGCTATATAAGAACTGCCCCAAAGCA
                    ************************************************************

HsCD00005106        ATGAAGAGGCTGGTAGCTGACTGTGTGAAGAAAGTAAAGGAAGAGAGGCCTCTTTTTCCC
XM_005265355.1      ATGAAGAGGCTGGTAGCTGACTGTGTGAAGAAAGTAAAGGAAGAGAGGCCTCTTTTTCCC
NM_002880.3         ATGAAGAGGCTGGTAGCTGACTGTGTGAAGAAAGTAAAGGAAGAGAGGCCTCTTTTTCCC
XM_005265357.1      ATGAAGAGGCTGGTAGCTGACTGTGTGAAGAAAGTAAAGGAAGAGAGGCCTCTTTTTCCC
                    ************************************************************

HsCD00005106        CAGATCCTGTCTTCCATTGAGCTGCTCCAACACTCTCTACCGAAGATCAACCGGAGCGCT
XM_005265355.1      CAGATCCTGTCTTCCATTGAGCTGCTCCAACACTCTCTACCGAAGATCAACCGGAGCGCT
NM_002880.3         CAGATCCTGTCTTCCATTGAGCTGCTCCAACACTCTCTACCGAAGATCAACCGGAGCGCT
XM_005265357.1      CAGATCCTGTCTTCCATTGAGCTGCTCCAACACTCTCTACCGAAGATCAACCGGAGCGCT
                    ************************************************************

HsCD00005106        TCCGAGCCATCCTTGCATCGGGCAGCCCACACTGAGGATATCAATGCTTGCACGCTGACC
XM_005265355.1      TCCGAGCCATCCTTGCATCGGGCAGCCCACACTGAGGATATCAATGCTTGCACGCTGACC
NM_002880.3         TCCGAGCCATCCTTGCATCGGGCAGCCCACACTGAGGATATCAATGCTTGCACGCTGACC
XM_005265357.1      TCCGAGCCATCCTTGCATCGGGCAGCCCACACTGAGGATATCAATGCTTGCACGCTGACC
                    ************************************************************

HsCD00005106        ACGTCCCCGAGGCTGCCTGTCTTCTAG
XM_005265355.1      ACGTCCCCGAGGCTGCCTGTCTTCTAG
NM_002880.3         ACGTCCCCGAGGCTGCCTGTCTTCTAG
XM_005265357.1      ACGTCCCCGAGGCTGCCTGTCTTCTAG
                    ***************************

Pathways

NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Ceramide signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IGF1 pathway
NCI : IL2-mediated signaling events
NCI : Internalization of ErbB1
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of retinoblastoma protein
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : Angiogenesis
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Reactome : ARMS-mediated activation
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GP1b-IX-V activation signalling
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : Ion channel transport
Reactome : MEK activation
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Platelet activation, signaling and aggregation
Reactome : Post NMDA receptor activation events
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : Rap1 signalling
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Stimuli-sensing channels
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : FSH signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 127857
HIP Master Clone ID : 104006
Original Clone ID : FLH127857.01X

Organism


TAX_ID : 9606
Species Specific ID: 5894

Genome

Chromosome : 3
Map Location : 3p25
Ensembl : ENSG00000132155

Reagents

Labome : Raf-1-antibody