DNASU Plasmid Repository • 480.965.5697 | Email

CCT6A (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCT6A
Gene Name:  chaperonin containing TCP1, subunit 6A (zeta 1)
Sequence             
Original Clone ID: ccsbBroadEn_00241
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC106942.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00513294

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1594nts         Open reading frame : 1 to 1594
Reference Sequence Alignment

ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTG
GCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCC
AAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAGACGGC
AATGTGCTGCTTCACGAAATGCAAATTCAACACCCAACAGCTTCCTTAATAGCAAAGGTA
GCAACAGCCCAGGATGATATAACTGGTGATGGTACGACTTCTAATGTCCTAATCATTGGA
GAGCTGCTGAAACAGGCGGATCTCTACATTTCTGAAGGCCTTCATCCTAGAATAATCACT
GAAGGATTTGAAGCTGCAAAGGAAAAGGCCCTTCAGTTTTTGGAAGAAGTCAAAGTAAGC
AGAGAGATGGACAGGGAAACACTTATAGATGTGGCCAGAACATCTCTTCGTACTAAAGTT
CATGCTGAACTTGCAGATGTCTTAACAGAGGCTGTAGTGGACTCCATTTTGGCCATTAAA
AAGCAAGATGAACCTATTGATCTCTTCATGATTGAGATCATGGAGATGAAACATAAATCT
GAAACTGATACAAGCTTAATCAGAGGGCTTGTTTTGGACCACGGAGCACGGCATCCTGAT
ATGAAGAAAAGGGTGGAGGATGCATACATCCTCACTTGTAACGTGTCATTAGAGTATGAG
AAAACAGAAGTGAATTCTGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAAAAACTCGTG
AAAGCTGAAAGAAAATTCATTGAAGATAGGGTTAAAAAAATAATAGAACTGAAAAGGAAA
GTCTGTGGCGATTCAGATAAAGGATTTGTTGTTATTAATCAAAAGGGAATTGACCCCTTT
TCCTTAGATGCTCTTTCAAAAGAAGGCATAGTTGCTCTGCGCAGAGCTAAAAGGAGAAAT
ATGGAGAGGCTGACTCTTGCTTGTGGTGGGGTAGCCCTGAATTCTTTTGACGACCTAAGT
CCTGACTGCTTGGGACATGCAGGACTTGTATATGAGTATACATTGGGAGAAGAGAAGTTT
ACCTTTATTGAGAAATGTAACAACCCTCGTTCTGTCACATTATTGATCAAAGGACCAAAT
AAGCACACACTCACTCAGATCAAAGATGCAGTGAGGGACGGCTTGAGGGCTGTCAAAAAT
GCTATTGATGATGGCTGTGTGGTTCCAGGTGCTGGTGCCGTGGAAGTGGCAATGGCAGAA
GCCCTGATTAAACATAAGCCCAGTGTAAAGGGCAGGGCACAGCTTGGAGTCCAAGCATTT
GCTGATGCATTGCTCATTATTCCCAAGGTTCTTGCTCAGAACTCTGGTTTTGACCTTCAG
GAAACATTAGTTAAAATTCAAGCAGAACATTCAGAATCAGGTCAGCTTGTGGGTGTGGAC
CTGAACACAGGTGAGCCAATGGTGGCAGCAGAAGTAGGCGTATGGGATAACTATTGTGTA
AAGAAACAGCTTCTTCACTCCTGCACTGTGATTGCCACCAACATTCTCTTGGTTGATGAG
ATCATGCGAGCTGGAATGTCTTCTCTGAAAGGT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCT6A
Symbol Nomenclature : CCT6A
SYNONYM : CCT-zeta; CCT-zeta-1; CCT6; Cctz; HTR3; MoDP-2; TCP-1-zeta; TCP20; TCPZ; TTCP20
Designation : T-complex protein 1 subunit zeta|T-complex protein 1, zeta subunit|acute morphine dependence related protein 2|acute morphine dependence-related protein 2|amino acid transport defect-complementing|chaperonin containing T-complex subunit 6|histidine transport regulator 3
Full Nomenclature : chaperonin containing TCP1, subunit 6A (zeta 1)
GENEID : 908
HGNC : 1620
MIM : 104613
Vega : OTTHUMG00000022842
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00513294        ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTG
NM_001762.3         ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTG
NM_001009186.1      ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTG
                    ************************************************************

HsCD00513294        GCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCC
NM_001762.3         GCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCC
NM_001009186.1      GCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCC
                    ************************************************************

HsCD00513294        AAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAGACGGC
NM_001762.3         AAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAGACGGC
NM_001009186.1      AAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAGACGGC
                    ************************************************************

HsCD00513294        AATGTGCTGCTTCACGAAATGCAAATTCAACACCCAACAGCTTCCTTAATAGCAAAGGTA
NM_001762.3         AATGTGCTGCTTCACGAAATGCAAATTCAACACCCAACAGCTTCCTTAATAGCAAAGGTA
NM_001009186.1      AATGTGCTGCTTCACGAAAT----------------------------------------
                    ********************                                        

HsCD00513294        GCAACAGCCCAGGATGATATAACTGGTGATGGTACGACTTCTAATGTCCTAATCATTGGA
NM_001762.3         GCAACAGCCCAGGATGATATAACTGGTGATGGTACGACTTCTAATGTCCTAATCATTGGA
NM_001009186.1      ------------------------------------------------------------
                                                                                

HsCD00513294        GAGCTGCTGAAACAGGCGGATCTCTACATTTCTGAAGGCCTTCATCCTAGAATAATCACT
NM_001762.3         GAGCTGCTGAAACAGGCGGATCTCTACATTTCTGAAGGCCTTCATCCTAGAATAATCACT
NM_001009186.1      -----------------------------------GGGCCTTCATCCTAGAATAATCACT
                                                       .************************

HsCD00513294        GAAGGATTTGAAGCTGCAAAGGAAAAGGCCCTTCAGTTTTTGGAAGAAGTCAAAGTAAGC
NM_001762.3         GAAGGATTTGAAGCTGCAAAGGAAAAGGCCCTTCAGTTTTTGGAAGAAGTCAAAGTAAGC
NM_001009186.1      GAAGGATTTGAAGCTGCAAAGGAAAAGGCCCTTCAGTTTTTGGAAGAAGTCAAAGTAAGC
                    ************************************************************

HsCD00513294        AGAGAGATGGACAGGGAAACACTTATAGATGTGGCCAGAACATCTCTTCGTACTAAAGTT
NM_001762.3         AGAGAGATGGACAGGGAAACACTTATAGATGTGGCCAGAACATCTCTTCGTACTAAAGTT
NM_001009186.1      AGAGAGATGGACAGGGAAACACTTATAGATGTGGCCAGAACATCTCTTCGTACTAAAGTT
                    ************************************************************

HsCD00513294        CATGCTGAACTTGCAGATGTCTTAACAGAGGCTGTAGTGGACTCCATTTTGGCCATTAAA
NM_001762.3         CATGCTGAACTTGCAGATGTCTTAACAGAGGCTGTAGTGGACTCCATTTTGGCCATTAAA
NM_001009186.1      CATGCTGAACTTGCAGATGTCTTAACAGAGGCTGTAGTGGACTCCATTTTGGCCATTAAA
                    ************************************************************

HsCD00513294        AAGCAAGATGAACCTATTGATCTCTTCATGATTGAGATCATGGAGATGAAACATAAATCT
NM_001762.3         AAGCAAGATGAACCTATTGATCTCTTCATGATTGAGATCATGGAGATGAAACATAAATCT
NM_001009186.1      AAGCAAGATGAACCTATTGATCTCTTCATGATTGAGATCATGGAGATGAAACATAAATCT
                    ************************************************************

HsCD00513294        GAAACTGATACAAGCTTAATCAGAGGGCTTGTTTTGGACCACGGAGCACGGCATCCTGAT
NM_001762.3         GAAACTGATACAAGCTTAATCAGAGGGCTTGTTTTGGACCACGGAGCACGGCATCCTGAT
NM_001009186.1      GAAACTGATACAAGCTTAATCAGAGGGCTTGTTTTGGACCACGGAGCACGGCATCCTGAT
                    ************************************************************

HsCD00513294        ATGAAGAAAAGGGTGGAGGATGCATACATCCTCACTTGTAACGTGTCATTAGAGTATGAG
NM_001762.3         ATGAAGAAAAGGGTGGAGGATGCATACATCCTCACTTGTAACGTGTCATTAGAGTATGAG
NM_001009186.1      ATGAAGAAAAGGGTGGAGGATGCATACATCCTCACTTGTAACGTGTCATTAGAGTATGAG
                    ************************************************************

HsCD00513294        AAAACAGAAGTGAATTCTGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAAAAACTCGTG
NM_001762.3         AAAACAGAAGTGAATTCTGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAAAAACTCGTG
NM_001009186.1      AAAACAGAAGTGAATTCTGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAAAAACTCGTG
                    ************************************************************

HsCD00513294        AAAGCTGAAAGAAAATTCATTGAAGATAGGGTTAAAAAAATAATAGAACTGAAAAGGAAA
NM_001762.3         AAAGCTGAAAGAAAATTCATTGAAGATAGGGTTAAAAAAATAATAGAACTGAAAAGGAAA
NM_001009186.1      AAAGCTGAAAGAAAATTCATTGAAGATAGGGTTAAAAAAATAATAGAACTGAAAAGGAAA
                    ************************************************************

HsCD00513294        GTCTGTGGCGATTCAGATAAAGGATTTGTTGTTATTAATCAAAAGGGAATTGACCCCTTT
NM_001762.3         GTCTGTGGCGATTCAGATAAAGGATTTGTTGTTATTAATCAAAAGGGAATTGACCCCTTT
NM_001009186.1      GTCTGTGGCGATTCAGATAAAGGATTTGTTGTTATTAATCAAAAGGGAATTGACCCCTTT
                    ************************************************************

HsCD00513294        TCCTTAGATGCTCTTTCAAAAGAAGGCATAGTTGCTCTGCGCAGAGCTAAAAGGAGAAAT
NM_001762.3         TCCTTAGATGCTCTTTCAAAAGAAGGCATAGTTGCTCTGCGCAGAGCTAAAAGGAGAAAT
NM_001009186.1      TCCTTAGATGCTCTTTCAAAAGAAGGCATAGTTGCTCTGCGCAGAGCTAAAAGGAGAAAT
                    ************************************************************

HsCD00513294        ATGGAGAGGCTGACTCTTGCTTGTGGTGGGGTAGCCCTGAATTCTTTTGACGACCTAAGT
NM_001762.3         ATGGAGAGGCTGACTCTTGCTTGTGGTGGGGTAGCCCTGAATTCTTTTGACGACCTAAGT
NM_001009186.1      ATGGAGAGGCTGACTCTTGCTTGTGGTGGGGTAGCCCTGAATTCTTTTGACGACCTAAGT
                    ************************************************************

HsCD00513294        CCTGACTGCTTGGGACATGCAGGACTTGTATATGAGTATACATTGGGAGAAGAGAAGTTT
NM_001762.3         CCTGACTGCTTGGGACATGCAGGACTTGTATATGAGTATACATTGGGAGAAGAGAAGTTT
NM_001009186.1      CCTGACTGCTTGGGACATGCAGGACTTGTATATGAGTATACATTGGGAGAAGAGAAGTTT
                    ************************************************************

HsCD00513294        ACCTTTATTGAGAAATGTAACAACCCTCGTTCTGTCACATTATTGATCAAAGGACCAAAT
NM_001762.3         ACCTTTATTGAGAAATGTAACAACCCTCGTTCTGTCACATTATTGATCAAAGGACCAAAT
NM_001009186.1      ACCTTTATTGAGAAATGTAACAACCCTCGTTCTGTCACATTATTGATCAAAGGACCAAAT
                    ************************************************************

HsCD00513294        AAGCACACACTCACTCAGATCAAAGATGCAGTGAGGGACGGCTTGAGGGCTGTCAAAAAT
NM_001762.3         AAGCACACACTCACTCAGATCAAAGATGCAGTGAGGGACGGCTTGAGGGCTGTCAAAAAT
NM_001009186.1      AAGCACACACTCACTCAGATCAAAGATGCAGTGAGGGACGGCTTGAGGGCTGTCAAAAAT
                    ************************************************************

HsCD00513294        GCTATTGATGATGGCTGTGTGGTTCCAGGTGCTGGTGCCGTGGAAGTGGCAATGGCAGAA
NM_001762.3         GCTATTGATGATGGCTGTGTGGTTCCAGGTGCTGGTGCCGTGGAAGTGGCAATGGCAGAA
NM_001009186.1      GCTATTGATGATGGCTGTGTGGTTCCAGGTGCTGGTGCCGTGGAAGTGGCAATGGCAGAA
                    ************************************************************

HsCD00513294        GCCCTGATTAAACATAAGCCCAGTGTAAAGGGCAGGGCACAGCTTGGAGTCCAAGCATTT
NM_001762.3         GCCCTGATTAAACATAAGCCCAGTGTAAAGGGCAGGGCACAGCTTGGAGTCCAAGCATTT
NM_001009186.1      GCCCTGATTAAACATAAGCCCAGTGTAAAGGGCAGGGCACAGCTTGGAGTCCAAGCATTT
                    ************************************************************

HsCD00513294        GCTGATGCATTGCTCATTATTCCCAAGGTTCTTGCTCAGAACTCTGGTTTTGACCTTCAG
NM_001762.3         GCTGATGCATTGCTCATTATTCCCAAGGTTCTTGCTCAGAACTCTGGTTTTGACCTTCAG
NM_001009186.1      GCTGATGCATTGCTCATTATTCCCAAGGTTCTTGCTCAGAACTCTGGTTTTGACCTTCAG
                    ************************************************************

HsCD00513294        GAAACATTAGTTAAAATTCAAGCAGAACATTCAGAATCAGGTCAGCTTGTGGGTGTGGAC
NM_001762.3         GAAACATTAGTTAAAATTCAAGCAGAACATTCAGAATCAGGTCAGCTTGTGGGTGTGGAC
NM_001009186.1      GAAACATTAGTTAAAATTCAAGCAGAACATTCAGAATCAGGTCAGCTTGTGGGTGTGGAC
                    ************************************************************

HsCD00513294        CTGAACACAGGTGAGCCAATGGTGGCAGCAGAAGTAGGCGTATGGGATAACTATTGTGTA
NM_001762.3         CTGAACACAGGTGAGCCAATGGTGGCAGCAGAAGTAGGCGTATGGGATAACTATTGTGTA
NM_001009186.1      CTGAACACAGGTGAGCCAATGGTGGCAGCAGAAGTAGGCGTATGGGATAACTATTGTGTA
                    ************************************************************

HsCD00513294        AAGAAACAGCTTCTTCACTCCTGCACTGTGATTGCCACCAACATTCTCTTGGTTGATGAG
NM_001762.3         AAGAAACAGCTTCTTCACTCCTGCACTGTGATTGCCACCAACATTCTCTTGGTTGATGAG
NM_001009186.1      AAGAAACAGCTTCTTCACTCCTGCACTGTGATTGCCACCAACATTCTCTTGGTTGATGAG
                    ************************************************************

HsCD00513294        ATCATGCGAGCTGGAATGTCTTCTCTGAAAGGT---
NM_001762.3         ATCATGCGAGCTGGAATGTCTTCTCTGAAAGGTTGA
NM_001009186.1      ATCATGCGAGCTGGAATGTCTTCTCTGAAAGGTTGA
                    *********************************   

Pathways

Reactome : Association of TriC/CCT with target proteins during biosynthesis
Reactome : Chaperonin-mediated protein folding
Reactome : Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding
Reactome : Folding of actin by CCT/TriC
Reactome : Formation of tubulin folding intermediates by CCT/TriC
Reactome : Metabolism of proteins
Reactome : Prefoldin mediated transfer of substrate to CCT/TriC
Reactome : Protein folding

Protein

HPRD : 00089

Clone

Cloning Information : 669878
Original Clone ID : ccsbBroadEn_00241

Organism


TAX_ID : 9606
Species Specific ID: 908

Genome

Chromosome : 7
Map Location : 7p11.2
Ensembl : ENSG00000146731

Reagents

Labome : CCT6A-antibody