DNASU Plasmid Repository • 480.965.5697 | Email

GPC1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GPC1
Gene Name:  glypican 1
Sequence             
Original Clone ID: ccsbBroadEn_06304
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC051279.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00515937

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1675nts         Open reading frame : 1 to 1675
Reference Sequence Alignment

ATGGAGCTCCGGGCCCGAGGCTGGTGGCTGCTATGTGCGGCCGCAGCGCTGGTCGCCTGC
GCCCGCGGGGACCCGGCCAGCAAGAGCCGGAGCTGCGGCGAGGTCCGCCAGATCTACGGA
GCCAAGGGCTTCAGCCTGAGCGACGTGCCCCAGGCGGAGATCTCGGGTGAGCACCTGCGG
ATCTGTCCCCAGGGCTACACCTGCTGCACCAGCGAGATGGAGGAGAACCTGGCCAACCGC
AGCCATGCCGAGCTGGAGACCGCGCTCCGGGACAGCAGCCGCGTCCTGCAGGCCATGCTT
GCCACCCAGCTGCGCAGCTTCGATGACCACTTCCAGCACCTGCTGAACGACTCGGAGCGG
ACGCTGCAGGCCACCTTCCCCGGCGCCTTCGGAGAGCTGTACACGCAGAACGCGAGGGCC
TTCCGGGACCTGTACTCAGAGCTGCGCCTGTACTACCGCGGTGCCAACCTGCACCTGGAG
GAGACGCTGGCCGAGTTCTGGGCCCGCCTGCTCGAGCGCCTCTTCAAGCAGCTGCACCCC
CAGCTGCTGCTGCCTGATGACTACCTGGACTGCCTGGGCAAGCAGGCCGAGGCGCTGCGG
CCCTTCGGGGAGGCCCCGAGAGAGCTGCGCCTGCGGGCCACCCGTGCCTTCGTGGCTGCT
CGCTCCTTTGTGCAGGGCCTGGGCGTGGCCAGCGACGTGGTCCGGAAAGTGGCTCAGGTC
CCCCTGGGCCCGGAGTGCTCGAGAGCTGTCATGAAGCTGGTCTACTGTGCTCACTGCCTG
GGAGTCCCCGGCGCCAGGCCCTGCCCTGACTATTGCCGAAATGTGCTCAAGGGCTGCCTT
GCCAACCAGGCCGACCTGGACGCCGAGTGGAGGAACCTCCTGGACTCCATGGTGCTCATC
ACCGACAAGTTCTGGGGTACATCGGGTGTGGAGAGTGTCATCGGCAGCGTGCACACGTGG
CTGGCGGAGGCCATCAACGCCCTCCAGGACAACAGGGACACGCTCACGGCCAAGGTCATC
CAGGGCTGCGGGAACCCCAAGGTCAACCCCCAGGGCCCTGGGCCTGAGGAGAAGCGGCGC
CGGGGCAAGCTGGCCCCGCGGGAGAGGCCACCTTCAGGCACGCTGGAGAAGCTGGTCTCT
GAAGCCAAGGCCCAGCTCCGCGACGTCCAGGACTTCTGGATCAGCCTCCCAGGGACACTG
TGCAGTGAGAAGATGGCCCTGAGCACTGCCAGTGATGACCGCTGCTGGAACGGGATGGCC
AGAGGCCGGTACCTCCCCGAGGTCATGGGTGACGGCCTGGCCAACCAGATCAACAACCCC
GAGGTGGAGGTGGACATCACCAAGCCGGACATGACCATCCGGCAGCAGATCATGCAGCTG
AAGATCATGACCAACCGGCTGCGCAGCGCCTACAACGGCAACGACGTGGACTTCCAGGAC
GCCAGTGACGACGGCAGCGGCTCGGGCAGCGGTGATGGCTGTCTGGATGACCTCTGCGGC
CGGAAGGTCAGCAGGAAGAGCTCCAGCTCCCGGACGCCCTTGACCCATGCCCTCCCAGGC
CTGTCAGAGCAGGAAGGACAGAAGACCTCGGCTGCCAGCTGCCCCCAGCCCCCGACCTTC
CTCCTGCCCCTCCTCCTCTTCCTGGCCCTTACAGTAGCCAGGCCCCGGTGGCGG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GPC1
Symbol Nomenclature : GPC1
SYNONYM : glypican
Designation : glypican proteoglycan 1|glypican-1
Full Nomenclature : glypican 1
GENEID : 2817
HGNC : 4449
MIM : 600395
Vega : OTTHUMG00000133349
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00515937      ATGGAGCTCCGGGCCCGAGGCTGGTGGCTGCTATGTGCGGCCGCAGCGCTGGTCGCCTGC
NM_002081.2       ATGGAGCTCCGGGCCCGAGGCTGGTGGCTGCTATGTGCGGCCGCAGCGCTGGTCGCCTGC
                  ************************************************************

HsCD00515937      GCCCGCGGGGACCCGGCCAGCAAGAGCCGGAGCTGCGGCGAGGTCCGCCAGATCTACGGA
NM_002081.2       GCCCGCGGGGACCCGGCCAGCAAGAGCCGGAGCTGCGGCGAGGTCCGCCAGATCTACGGA
                  ************************************************************

HsCD00515937      GCCAAGGGCTTCAGCCTGAGCGACGTGCCCCAGGCGGAGATCTCGGGTGAGCACCTGCGG
NM_002081.2       GCCAAGGGCTTCAGCCTGAGCGACGTGCCCCAGGCGGAGATCTCGGGTGAGCACCTGCGG
                  ************************************************************

HsCD00515937      ATCTGTCCCCAGGGCTACACCTGCTGCACCAGCGAGATGGAGGAGAACCTGGCCAACCGC
NM_002081.2       ATCTGTCCCCAGGGCTACACCTGCTGCACCAGCGAGATGGAGGAGAACCTGGCCAACCGC
                  ************************************************************

HsCD00515937      AGCCATGCCGAGCTGGAGACCGCGCTCCGGGACAGCAGCCGCGTCCTGCAGGCCATGCTT
NM_002081.2       AGCCATGCCGAGCTGGAGACCGCGCTCCGGGACAGCAGCCGCGTCCTGCAGGCCATGCTT
                  ************************************************************

HsCD00515937      GCCACCCAGCTGCGCAGCTTCGATGACCACTTCCAGCACCTGCTGAACGACTCGGAGCGG
NM_002081.2       GCCACCCAGCTGCGCAGCTTCGATGACCACTTCCAGCACCTGCTGAACGACTCGGAGCGG
                  ************************************************************

HsCD00515937      ACGCTGCAGGCCACCTTCCCCGGCGCCTTCGGAGAGCTGTACACGCAGAACGCGAGGGCC
NM_002081.2       ACGCTGCAGGCCACCTTCCCCGGCGCCTTCGGAGAGCTGTACACGCAGAACGCGAGGGCC
                  ************************************************************

HsCD00515937      TTCCGGGACCTGTACTCAGAGCTGCGCCTGTACTACCGCGGTGCCAACCTGCACCTGGAG
NM_002081.2       TTCCGGGACCTGTACTCAGAGCTGCGCCTGTACTACCGCGGTGCCAACCTGCACCTGGAG
                  ************************************************************

HsCD00515937      GAGACGCTGGCCGAGTTCTGGGCCCGCCTGCTCGAGCGCCTCTTCAAGCAGCTGCACCCC
NM_002081.2       GAGACGCTGGCCGAGTTCTGGGCCCGCCTGCTCGAGCGCCTCTTCAAGCAGCTGCACCCC
                  ************************************************************

HsCD00515937      CAGCTGCTGCTGCCTGATGACTACCTGGACTGCCTGGGCAAGCAGGCCGAGGCGCTGCGG
NM_002081.2       CAGCTGCTGCTGCCTGATGACTACCTGGACTGCCTGGGCAAGCAGGCCGAGGCGCTGCGG
                  ************************************************************

HsCD00515937      CCCTTCGGGGAGGCCCCGAGAGAGCTGCGCCTGCGGGCCACCCGTGCCTTCGTGGCTGCT
NM_002081.2       CCCTTCGGGGAGGCCCCGAGAGAGCTGCGCCTGCGGGCCACCCGTGCCTTCGTGGCTGCT
                  ************************************************************

HsCD00515937      CGCTCCTTTGTGCAGGGCCTGGGCGTGGCCAGCGACGTGGTCCGGAAAGTGGCTCAGGTC
NM_002081.2       CGCTCCTTTGTGCAGGGCCTGGGCGTGGCCAGCGACGTGGTCCGGAAAGTGGCTCAGGTC
                  ************************************************************

HsCD00515937      CCCCTGGGCCCGGAGTGCTCGAGAGCTGTCATGAAGCTGGTCTACTGTGCTCACTGCCTG
NM_002081.2       CCCCTGGGCCCGGAGTGCTCGAGAGCTGTCATGAAGCTGGTCTACTGTGCTCACTGCCTG
                  ************************************************************

HsCD00515937      GGAGTCCCCGGCGCCAGGCCCTGCCCTGACTATTGCCGAAATGTGCTCAAGGGCTGCCTT
NM_002081.2       GGAGTCCCCGGCGCCAGGCCCTGCCCTGACTATTGCCGAAATGTGCTCAAGGGCTGCCTT
                  ************************************************************

HsCD00515937      GCCAACCAGGCCGACCTGGACGCCGAGTGGAGGAACCTCCTGGACTCCATGGTGCTCATC
NM_002081.2       GCCAACCAGGCCGACCTGGACGCCGAGTGGAGGAACCTCCTGGACTCCATGGTGCTCATC
                  ************************************************************

HsCD00515937      ACCGACAAGTTCTGGGGTACATCGGGTGTGGAGAGTGTCATCGGCAGCGTGCACACGTGG
NM_002081.2       ACCGACAAGTTCTGGGGTACATCGGGTGTGGAGAGTGTCATCGGCAGCGTGCACACGTGG
                  ************************************************************

HsCD00515937      CTGGCGGAGGCCATCAACGCCCTCCAGGACAACAGGGACACGCTCACGGCCAAGGTCATC
NM_002081.2       CTGGCGGAGGCCATCAACGCCCTCCAGGACAACAGGGACACGCTCACGGCCAAGGTCATC
                  ************************************************************

HsCD00515937      CAGGGCTGCGGGAACCCCAAGGTCAACCCCCAGGGCCCTGGGCCTGAGGAGAAGCGGCGC
NM_002081.2       CAGGGCTGCGGGAACCCCAAGGTCAACCCCCAGGGCCCCGGGCCTGAGGAGAAGCGGCGC
                  ************************************** *********************

HsCD00515937      CGGGGCAAGCTGGCCCCGCGGGAGAGGCCACCTTCAGGCACGCTGGAGAAGCTGGTCTCT
NM_002081.2       CGGGGCAAGCTGGCCCCGCGGGAGAGGCCACCTTCAGGCACGCTGGAGAAGCTGGTCTCC
                  *********************************************************** 

HsCD00515937      GAAGCCAAGGCCCAGCTCCGCGACGTCCAGGACTTCTGGATCAGCCTCCCAGGGACACTG
NM_002081.2       GAAGCCAAGGCCCAGCTCCGCGACGTCCAGGACTTCTGGATCAGCCTCCCAGGGACACTG
                  ************************************************************

HsCD00515937      TGCAGTGAGAAGATGGCCCTGAGCACTGCCAGTGATGACCGCTGCTGGAACGGGATGGCC
NM_002081.2       TGCAGTGAGAAGATGGCCCTGAGCACTGCCAGTGATGACCGCTGCTGGAACGGGATGGCC
                  ************************************************************

HsCD00515937      AGAGGCCGGTACCTCCCCGAGGTCATGGGTGACGGCCTGGCCAACCAGATCAACAACCCC
NM_002081.2       AGAGGCCGGTACCTCCCCGAGGTCATGGGTGACGGCCTGGCCAACCAGATCAACAACCCC
                  ************************************************************

HsCD00515937      GAGGTGGAGGTGGACATCACCAAGCCGGACATGACCATCCGGCAGCAGATCATGCAGCTG
NM_002081.2       GAGGTGGAGGTGGACATCACCAAGCCGGACATGACCATCCGGCAGCAGATCATGCAGCTG
                  ************************************************************

HsCD00515937      AAGATCATGACCAACCGGCTGCGCAGCGCCTACAACGGCAACGACGTGGACTTCCAGGAC
NM_002081.2       AAGATCATGACCAACCGGCTGCGCAGCGCCTACAACGGCAACGACGTGGACTTCCAGGAC
                  ************************************************************

HsCD00515937      GCCAGTGACGACGGCAGCGGCTCGGGCAGCGGTGATGGCTGTCTGGATGACCTCTGCGGC
NM_002081.2       GCCAGTGACGACGGCAGCGGCTCGGGCAGCGGTGATGGCTGTCTGGATGACCTCTGCAGC
                  *********************************************************.**

HsCD00515937      CGGAAGGTCAGCAGGAAGAGCTCCAGCTCCCGGACGCCCTTGACCCATGCCCTCCCAGGC
NM_002081.2       CGGAAGGTCAGCAGGAAGAGCTCCAGCTCCCGGACGCCCTTGACCCATGCCCTCCCAGGC
                  ************************************************************

HsCD00515937      CTGTCAGAGCAGGAAGGACAGAAGACCTCGGCTGCCAGCTGCCCCCAGCCCCCGACCTTC
NM_002081.2       CTGTCAGAGCAGGAAGGACAGAAGACCTCGGCTGCCAGCTGCCCCCAGCCCCCGACCTTC
                  ************************************************************

HsCD00515937      CTCCTGCCCCTCCTCCTCTTCCTGGCCCTTACAGTAGCCAGGCCCCGGTGGCGG---
NM_002081.2       CTCCTGCCCCTCCTCCTCTTCCTGGCCCTTACAGTAGCCAGGCCCCGGTGGCGGTAA
                  ******************************************************   

Pathways

NCI : Glypican 1 network
NCI : Glypican pathway
Reactome : A tetrasaccharide linker sequence is required for GAG synthesis
Reactome : Activation of Rac
Reactome : Axon guidance
Reactome : Chondroitin sulfate/dermatan sulfate metabolism
Reactome : Developmental Biology
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : HS-GAG biosynthesis
Reactome : HS-GAG degradation
Reactome : Heparan sulfate/heparin (HS-GAG) metabolism
Reactome : Inactivation of Cdc42 and Rac
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
Reactome : Retinoid metabolism and transport
Reactome : Role of Abl in Robo-Slit signaling
Reactome : Signal Transduction
Reactome : Signaling by Robo receptor
Reactome : Visual phototransduction

Protein

HPRD : 02671

Clone

Cloning Information : 669612
Original Clone ID : ccsbBroadEn_06304

Organism


TAX_ID : 9606
Species Specific ID: 2817

Genome

Chromosome : 2
Map Location : 2q35-q37
Ensembl : ENSG00000063660

Reagents

Labome : GPC1-antibody