DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CA (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CA
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Sequence             
Original Clone ID: PIK3CA_pDONR221_Fusion
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
Brianne Petritis
HsCD00520183

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3207nts         Open reading frame : 1 to 3207
Reference Sequence Alignment

ATGCCTCCACGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATC
CTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCT
ACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAA
CTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACTCAAGAAGCAGAAAGGGAA
GAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAA
GTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCT
ATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
AGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCAT
AGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC
ATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCA
AATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTA
ATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAA
CTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATAC
TTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGAC
TGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGA
GAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGT
GCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATC
TACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAAT
CCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCT
CGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAA
ATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGT
GTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTC
AGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTA
TCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGAC
AATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTC
TCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTA
GCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAA
CTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAA
AAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAA
TATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAAT
CAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTT
AGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAA
CAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGG
CGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAA
CTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGG
TTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATC
TTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATG
GAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATT
CAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGG
CTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCA
TGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAAC
ATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATTTTGGACACTTTTTGGATCAC
AAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTC
TTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAAT
CTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCA
TACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATG
AAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCAC
ACAATTAAACAGCATGCATTGAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : PIK3CA
Symbol Nomenclature : PIK3CA
SYNONYM : CLOVE; CWS5; MCAP; MCM; MCMTC; PI3K; p110-alpha
Designation : PI3-kinase p110 subunit alpha|PI3K-alpha|phosphatidylinositol 3-kinase, catalytic, 110-KD, alpha|phosphatidylinositol 3-kinase, catalytic, alpha polypeptide|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit alpha|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit, alpha isoform|phosphoinositide-3-kinase, catalytic, alpha polypeptide|ptdIns-3-kinase subunit p110-alpha|serine/threonine protein kinase PIK3CA
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
GENEID : 5290
GenBank Accession : BC113603
HGNC : 8975
MIM : 171834
Target GenBank: BC113603

 

Reference Sequence Alignment

  

HsCD00520183      ATGCCTCCACGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATC
NM_006218.2       ATGCCTCCACGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATC
                  ************************************************************

HsCD00520183      CTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCT
NM_006218.2       CTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCT
                  ************************************************************

HsCD00520183      ACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAA
NM_006218.2       ACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAA
                  ************************************************************

HsCD00520183      CTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACTCAAGAAGCAGAAAGGGAA
NM_006218.2       CTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACTCAAGAAGCAGAAAGGGAA
                  ************************************************************

HsCD00520183      GAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAA
NM_006218.2       GAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAA
                  ************************************************************

HsCD00520183      GTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCT
NM_006218.2       GTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCT
                  ************************************************************

HsCD00520183      ATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
NM_006218.2       ATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
                  ************************************************************

HsCD00520183      AGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCAT
NM_006218.2       AGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCAT
                  ************************************************************

HsCD00520183      AGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC
NM_006218.2       AGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC
                  ************************************************************

HsCD00520183      ATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCA
NM_006218.2       ATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCA
                  ************************************************************

HsCD00520183      AATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTA
NM_006218.2       AATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTA
                  ************************************************************

HsCD00520183      ATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAA
NM_006218.2       ATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAA
                  ************************************************************

HsCD00520183      CTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATAC
NM_006218.2       CTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATAC
                  ************************************************************

HsCD00520183      TTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
NM_006218.2       TTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
                  ************************************************************

HsCD00520183      AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGAC
NM_006218.2       AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGAC
                  ************************************************************

HsCD00520183      TGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGA
NM_006218.2       TGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGA
                  ************************************************************

HsCD00520183      GAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGT
NM_006218.2       GAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGT
                  ************************************************************

HsCD00520183      GCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATC
NM_006218.2       GCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATC
                  ************************************************************

HsCD00520183      TACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAAT
NM_006218.2       TACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAAT
                  ************************************************************

HsCD00520183      CCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCT
NM_006218.2       CCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCT
                  ************************************************************

HsCD00520183      CGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
NM_006218.2       CGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
                  ************************************************************

HsCD00520183      CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAA
NM_006218.2       CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAA
                  ************************************************************

HsCD00520183      ATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGT
NM_006218.2       ATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGT
                  ************************************************************

HsCD00520183      GTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTC
NM_006218.2       GTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTC
                  ************************************************************

HsCD00520183      AGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTA
NM_006218.2       AGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTA
                  ************************************************************

HsCD00520183      TCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGAC
NM_006218.2       TCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGAC
                  ************************************************************

HsCD00520183      AATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTC
NM_006218.2       AATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTC
                  ************************************************************

HsCD00520183      TCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
NM_006218.2       TCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
                  ************************************************************

HsCD00520183      ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTA
NM_006218.2       ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTA
                  ************************************************************

HsCD00520183      GCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAA
NM_006218.2       GCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAA
                  ************************************************************

HsCD00520183      CTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAA
NM_006218.2       CTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAA
                  ************************************************************

HsCD00520183      AAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAA
NM_006218.2       AAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAA
                  ************************************************************

HsCD00520183      TATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAAT
NM_006218.2       TATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAAT
                  ************************************************************

HsCD00520183      CAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTT
NM_006218.2       CAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTT
                  ************************************************************

HsCD00520183      AGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
NM_006218.2       AGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
                  ************************************************************

HsCD00520183      CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAA
NM_006218.2       CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAA
                  ************************************************************

HsCD00520183      CAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGG
NM_006218.2       CAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGG
                  ************************************************************

HsCD00520183      CGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAA
NM_006218.2       CGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAA
                  ************************************************************

HsCD00520183      CTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGG
NM_006218.2       CTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGG
                  ************************************************************

HsCD00520183      TTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATC
NM_006218.2       TTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATC
                  ************************************************************

HsCD00520183      TTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATG
NM_006218.2       TTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATG
                  ************************************************************

HsCD00520183      GAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
NM_006218.2       GAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
                  ************************************************************

HsCD00520183      ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATT
NM_006218.2       ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATT
                  ************************************************************

HsCD00520183      CAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGG
NM_006218.2       CAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGG
                  ************************************************************

HsCD00520183      CTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCA
NM_006218.2       CTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCA
                  ************************************************************

HsCD00520183      TGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAAC
NM_006218.2       TGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAAC
                  ************************************************************

HsCD00520183      ATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATTTTGGACACTTTTTGGATCAC
NM_006218.2       ATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATTTTGGACACTTTTTGGATCAC
                  ************************************************************

HsCD00520183      AAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTC
NM_006218.2       AAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTC
                  ************************************************************

HsCD00520183      TTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
NM_006218.2       TTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
                  ************************************************************

HsCD00520183      CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAAT
NM_006218.2       CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAAT
                  ************************************************************

HsCD00520183      CTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCA
NM_006218.2       CTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCA
                  ************************************************************

HsCD00520183      TACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATG
NM_006218.2       TACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATG
                  ************************************************************

HsCD00520183      AAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCAC
NM_006218.2       AAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCAC
                  ************************************************************

HsCD00520183      ACAATTAAACAGCATGCATTGAACTTG
NM_006218.2       ACAATTAAACAGCATGCATTGAACTGA
                  ************************* .

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHA2 forward signaling
NCI : EPHB forward signaling
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL1-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL3-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL5-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Insulin Pathway
NCI : Integrins in angiogenesis
NCI : Internalization of ErbB1
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Reelin signaling pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events mediated by the Hedgehog family
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : TRAIL signaling pathway
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : a6b1 and a6b4 Integrin signaling
NCI : p75(NTR)-mediated signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (12/13) signalling events
Reactome : G alpha (q) signalling events
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nephrin interactions
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 fusion mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
Reactome : Tie2 Signaling
WikiPathway : AMPK signaling
WikiPathway : Angiogenesis
WikiPathway : Estrogen signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Keap1-Nrf2 Pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 594204
Original Clone ID : PIK3CA_pDONR221_Fusion

Organism


TAX_ID : 9606
Species Specific ID: 5290

Genome

Chromosome : 3
Map Location : 3q26.3