DNASU Plasmid Repository • 480.965.5697 | Email

Klhl24 (Mus musculus) in pMH4 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Klhl24
Gene Name:  kelch-like 24
Sequence             
Original Clone ID: 12369
Keyword: full-length cds
Species: Mus musculus
Type: cDNA
Vector Name: pMH4               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
MmCD00530443

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1455nts         Open reading frame : 51 to 1505

GATATACCTACCCATGCGGATCTGATAAAATTCATCATCATCATCATCACATGGAATGTT
TTCTGCCGTATGCGTATACTGGGAAGGTGAAGATCACAACAGAGAATGTCCCGTACCTCT
TCGAAACCCCCCGCCTCTTTCAGATTAGTGTTCTCCGTGATGCTTGTGCCAAGTTCTTAC
AGGAACAGCTTGATCCTTGCAATTGCCTCGGAATCCAGCGCTTTGCCGACACCCACTCGC
TCAAAACACTCTTCACAAAATGCAAGACCTTTGCATTACAGACTTTTGAGGATGTGTCCC
AGCATGAAGAATTTCTCGAGCTTGACAAAGATGAACTTATTGATTATATCTGCAGTGATG
AACTTGTTATTGGTAAAGAGGAGATGGTTTTTGAGGCCGTCATGCGCTGGGTCTACCGGG
CGGTTGACCTGCGAAGACCACTGTTACATGAGCTCCTGACACACGTCAGGCTTCCTCTCT
TGCATCCCAACTACTTTGTTCAGACAGTTGAAGTGGACCAGTTGATCCAGAATTCCCCCG
AGTGTTATCAGTTGCTGCACGAAGCAAGACGATACCACATACTTGGCAATGAAATGATGT
CCCCAAGGACTAGGCCACGCAGGTCTACTGGCTATTCAGAGGTGATAGTTGTGGTTGGAG
GCTGTGAACGAGTTGGAGGATTTAATCTTCCATACACTGAGTGCTATGATCCAGTAACAG
GAGAATGGAAGTCCTTGGCCAAGCTTCCAGAATTTACCAAATCCGAGTATGCAGTCTGTG
CACTGAGGAATGATATTCTTGTTTCAGGTGGAAGAATCAACAGCCGTGATGTCTGGATTT
ATAATTCACAGTTAAATATCTGGATCAGAGTTGCTTCTCTAAATAAAGGCAGATGGCGTC
ACAAAATGGCTGTCCTTCTTGGTAAAGTGTATGTTGTTGGCGGCTATGATGGGCAAAACA
GGCTTAGCAGTGTGGAGTGTTACGATTCCTTTTCAAATCGTTGGACAGAAGTTGCTCCAC
TTAAGGAAGCAGTGAGCTCTCCTGCAGTGACAAGCTGTATAGGAAAATTGTTTGTGATTG
GTGGAGGACCTGATGATAATACTTGTTCTGATAAGGTCCAATCTTATGACCCAGAAACCA
ATTCTTGGCTACTTCGTGCAGCTATCCCTATCGCCAAGAGGTGCATCACAGCTGTCTCTT
TAAACAACCTGATCTACGTAGCTGGTGGGCTGACCAAGGCAGTGTATTGTTACGATCCCG
TTGAAGACTACTGGATGCATGTACAAAACACATTCAGCCGGCAGGAAAACTGTGGTATGT
CTGTTTGTAATGGTAAAATCTATATCCTGGGTGGAAGACGGGAAAATGGAGAAGCCACAG
ATACTATTCTCTGTTACGATCCTGCGACAAGTATCATCACAGGAGTGGCTGCAATGCCCA
GGCCAGTGTCCTACCACGGCTGTGTAACTATTCATAGATACAATGAGAAGTGCTTTAAGC
TCTAACGGGACTTAATTAACTCTAGATAACTGAGAAGGAGATATACATACCCGGGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
c9t,C3C;a17c,Q6P;
t23c,V8A;a62c,Q21P;

t79c,S27P;a82c,S28R;
g130c,E44Q
                                

5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Protein_Purified
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in 354760
Recommended expression in: BL21CodonPlus(DE3)RPX
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH4

pMH4 in advanced viewed

Synonyms: pMH-4
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enyzme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 5489
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1 bacterial origin of replication 3331 4013
inducible trxn activator protein gene araC araC cds 5463 4585
negative selection marker ccdB ccdB negative selection gene (may be gone in with-insert form) 1576 1785
promoter T7 T7 promoter 290 310
promoter araC araC promoter 153 124
selectable marker CmR chloramphenicol resistance gene (CmR) 484 1140
selectable marker AmpR ampicillin resistance gene 2574 3233
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 2238 2264

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : Klhl24
Symbol Nomenclature : Klhl24
SYNONYM : 1110046J11Rik; 4930429H24Rik; 6530402O20Rik; C85082
Designation : KRIP6|kainate receptor-interacting protein for GluR6|kelch-like protein 24
Full Nomenclature : kelch-like 24
GENEID : 75785
GI : 26381170
GenBank Accession : AK015239
Mouse Genome Informatics : 1923035
Target GenBank: None

 

Protein

SMART domain : BACK : BTB And C-terminal Kelch
SMART domain : Kelch :
Structural Annotation Wiki : 354760
UniProt : Q9D5K3

Clone

Cloning Information : 277531
HIP Master Clone ID : 207017
Original Clone ID : 12369

Experimental

TargetTrack - Experimental data : 354760

Organism


TAX_ID : 10090
Species Specific ID: 75785

Genome

Chromosome : 16
Map Location : 16|16 B1
Ensembl : ENSMUSG00000062901

Reagents

Labome : Klhl24-antibody