DNASU Plasmid Repository • 480.965.5697 | Email

MTH619 (M. thermautotrophicus str. Delta H ) in pNYCOMPS1

TOP

Explanation of Terms


Gene: Gene Symbol:  MTH619
Gene Name:  sensory transduction histidine kinase
Sequence             
Original Clone ID: GE.528.1.7_GO.13347
Keyword: None
Species: Methanothermobacter thermautotrophicus str. Delta H
Type: cDNA
Vector Name: pNYCOMPS1               Format:  FUSION
Source: New York Consortium on Membrane Protein Structure
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
New York Consortium on Membrane Protein Structure
MtCD00534150

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 2247nts         Open reading frame : 14 to 2260

AAGGAGATATACTATGGATAGGAACCTCAAGATATTCATAACGGTGATGTTAATTCTTTC
AGTCATATCCCAGTTCCTGCCCTTTAAAAGGGATGCTGTCTCACTTATAAACGTCATAAC
AAACCTTGCAGCCTTCATGGGACTTTCATATGCCTGCATATACTCCAGGAAGGTTTACCC
GCACCTTTACCTCACGTTGCTCCTTCTATCCGCTGCCCAGTTCTTTTCATTCCTCGGAGA
CTTCACCTGGTTCATACTTGAGAGTATACTGTCCCTGAATCCCTTCCCATCAGTTGCAGA
CCTGTTCTACCTCCTCTATTACCCCATCTTCGCAGCCGGCATATTCACAATACCCATCAA
AAGATACTCTGACCTTAGATCAATCATAGACCTGCTGATAATCCTCGTGGCCTCTGCATC
TGCCGCCTGGGTCTTCCTCCTTGAGCCCACAGTTTTTGCAGGAGGAGATTTCACAGAGGT
CCTGGTATCAACACTGTATGTCCTGGGCGATCTCCTCATAGTCTTCATGATAATGGACCT
CATAATAAACAAGCTGGGGCACCTCAGATCAAGGACCCTCCACGTGTTCCTTGCAAGCAT
AATCATCCTCCTTGCAGCAGATATATCCTTCACATACCAGAACCTTACAGGAATTTATGC
TGGAGGAACACCCCAGGACCTCCTCTGGGCATTCAGTTACATTCTCCTCCTCATTGCAGT
GAATGAATTCTTTAAGGAGGACTGGTCAAAGCCCTTATATGTTGAAAAAAAGGTCACAGC
TGTCACATACACCCCCTATATCTTTATAATACTGTTCTATCTCTTAACGGCCTACAGCGT
GATTAAGGGTGGTGCTGAAAAATCCACCGTGCTCTTAGTGTCCCTTGGATTCATAATAGT
CCTCTTCATTCTGAGGCAGCACCTTTCCATGAAGGAAAACATGGCCCTCCTCAATGATGT
TGAGAATGAAAGGAGGAGGGCTGAAAATTACCTGGAGGTGGCGGGGTCCCTCATAATGGT
CCTCGATGAGAAAACCCGTGTGAAGCTCATAAACAGGAGGGGCCTTGAAATCCTTGAGTG
TGACGCAGGGGAAGTCGCAGGGAAAAACTGGTTCATGACCTTCGTACCCCCTGAAGACAG
GGGGTGGCGGGAAAAGCTATACACCGAAAAGATCAGCTCCGGGAGTAAGGGTTATCATCT
GACCGGTGAGATACTCACATGTAAGGGCGACAGGAAAACCGTCACATGGCACGTTGTATT
CCTCAGGGAGGATGGTGAATTCAGGGGCAGCATAATCTCAGGGGATGACATCACAGAACT
CCAGAGAGCCACAAGGGCCCTCGAGATGAGTGAGATGAGGTACAGGGAGATATTTGAACT
CGCCCCTAGCCCGATAATATCGGTTGGTGATGACCTGATCATAAGGGACTGTAACAGGAG
GGCTGAATCCGTTCTGGGCTACCAGAGAGGGGAGCTGATTGGAAGGAACCTGATGGACCT
CATACACCCCGAGGATGCAGGAGAGGACTTTGAAGGGGAAAGAAGGCTCCTGAGATCAAA
TGGAGATGTCATATACGCCGATATAGGGGTCGCCCGGGTTGGGGATGAACGTATAATCAT
AATCGAGGACCAGACAGAGATACGCAGGTCCCTCCAGGAGAAGGAACTCCTCCTGAGGGA
GATACACCACCGGGTCAAGAACAACCTCCAGATAATATCAAGCCTGCTGAGCATACAGGA
GCGTCAGCTGGAGTCAGAGGAACTTTCAGATGTCCTGAGAGAGAGCCGTGAGCGTATAAG
GTCTATAGCCCTTGTCCATGAGCACCTCTACAGATCAACAAACCTCAGAACAATAAGGAT
CAGGAATTACCTCAACAACATCCTCTCAAAGCTGAGCCAGGGACAGACCCATGGGAAGGA
TGTGAGGATCAGCTCCAGCATAGAGGACCTTGAATTCAACCTTGAGACCAGTCTCCCCAT
TGGTCTCATGGTCAACGAACTTGTGAGTAACTCCCTCAAGCACTCAGGGGCAGATAACAT
AACCGTTGAGCTCAGATCCCTCAACGGGACCCTTGAACTTACCGTGAAGGATGATGGGAT
AGGCCTTGAATCACCGGAGGTCCTGGAGAAATCCGGAAGCATGGGCTGGTACCTTATACG
GGCCCTGACAGACCAGCTTGATGGTGAACTGAAAATAGAAACAGAGGATGGTCTATCTGT
AAGTTTAAGGTTCAGGGAACTTGGATACAGAGAAAGGTACGCCGAAAACCTCTATTTTCA
GGGACATCATCACCATCACC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
c1791t,S597S
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Tested_Not_Purified
SolubleProtein: Not_Applicable
Find experimental protocols in GO.13347
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pNYCOMPS1

pNYCOMPS1 in advanced viewed

Synonyms: pNYCOMPS-1
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 promoter, adds C-terminal EGFP and 10xHis tag; kanamycin resistance; restriction enzyme cloning (including rare-cutter cloning into MCS).
Comments: For the expression of membrane proteins in E.Coli, producing a fusion protein with a native N-terminus, and a C-terminal fusion of EGFP and a deca histadine tag. Requires C-term IN topology of MP for EGFP to be flourescent.
Size (bp): 6040
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: New York Consortium on Membrane Protein Structure
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 1421 2103
promoter T7 T7 promoter 4984 5003
repressor binding site lac operator lac operator 5003 5025
selectable marker KanR kanamycin resistance gene 563 1375
ssDNA origin f1 ori f1 origin 457 417
tag His C-terminal 10xHis tag 5845 5874
tag EGFP C-terminal EGFP tag 5131 5841
trxn regulatory element LacI LacI 3515 4594
trxn termination sequence T7 term T7 terminator 5969 6015

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : MTH619
GENEID : 1470580
Locus Tag : MTH619
GI : 15678647
Target GenBank: None

 

Protein

SMART domain : PAS : PAS domain
SMART domain : HATPase_c : Histidine kinase-like ATPases
Structural Annotation Wiki : GO.13347

Clone

Cloning Information : 553839
HIP Master Clone ID : 464159
Original Clone ID : GE.528.1.7_GO.13347

Experimental

TargetTrack - Experimental data : GO.13347

Organism


TAX_ID : 187420
Species Specific ID: 1470580

Reagents

Labome : MTH619-cDNA