DNASU Plasmid Repository • 480.965.5697 | Email

IRAK2 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IRAK2
Gene Name:  interleukin-1 receptor-associated kinase 2
Sequence             
Original Clone ID: HR3068G-1-99-14.4
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Northeast Structural Genomics Consortium
Rutgers University
HsCD00535950

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 300nts         Open reading frame : 51 to 350
Reference Sequence Alignment

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGGCGTGCT
ATATTTATCAGCTGCCGAGCTGGGTGCTGGATGATCTGTGCCGTAATATGGATGCGCTGA
GCGAATGGGATTGGATGGAATTTGCGAGCTATGTGATTACCGATCTGACCCAGCTGCGTA
AAATTAAAAGCATGGAACGTGTGCAGGGCGTGAGCATTACCCGTGAACTGCTGTGGTGGT
GGGGCATGCGTCAGGCGACCGTGCAGCAGCTGGTGGATCTGCTGTGCCGTCTGGAACTGT
ATCGTGCGGCGCAGATTATTCTGAACTGGAAACCGGCGCCGGAAATTTAGCTCGAGATCC
GGCTGCTAACAAAGCCCGAAAGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR3068G
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IRAK2
Symbol Nomenclature : IRAK2
SYNONYM : IRAK-2
Designation : interleukin-1 receptor associated kinase-2|interleukin-1 receptor-associated kinase-like 2
Full Nomenclature : interleukin-1 receptor-associated kinase 2
GENEID : 3656
GI : 58530886
GenBank Accession : NM_001570
HGNC : 6113
MIM : 603304
Vega : OTTHUMG00000155358
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00535950      CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGGCGTGCT
NM_001570.3       --------------------------------------------------ATGGCCTGCT
                                                                    ***** ****

HsCD00535950      ATATTTATCAGCTGCCGAGCTGGGTGCTGGATGATCTGTGCCGTAATATGGATGCGCTGA
NM_001570.3       ACATCTACCAGCTGCCCTCCTGGGTGCTGGACGACCTGTGCCGCAACATGGACGCGCTCA
                  * ** ** ******** : ************ ** ******** ** ***** ***** *

HsCD00535950      GCGAATGGGATTGGATGGAATTTGCGAGCTATGTGATTACCGATCTGACCCAGCTGCGTA
NM_001570.3       GCGAGTGGGACTGGATGGAGTTCGCCTCCTACGTGATCACAGACCTGACCCAGCTGCGGA
                  ****.***** ********.** ** : *** ***** **.** ************** *

HsCD00535950      AAATTAAAAGCATGGAACGTGTGCAGGGCGTGAGCATTACCCGTGAACTGCTGTGGTGGT
NM_001570.3       AGATCAAGTCCATGGAGCGGGTGCAGGGTGTGAGCATCACGCGGGAGCTGCTGTGGTGGT
                  *.** **.: ******.** ******** ******** ** ** **.*************

HsCD00535950      GGGGCATGCGTCAGGCGACCGTGCAGCAGCTGGTGGATCTGCTGTGCCGTCTGGAACTGT
NM_001570.3       GGGGCATGCGGCAGGCCACCGTCCAGCAACTTGTGGACCTCCTGTGCCGCCTGGAGCTCT
                  ********** ***** ***** *****.** ***** ** ******** *****.** *

HsCD00535950      ATCGTGCGGCGCAGATTATTCTGAACTGGAAACCGGCGCCGGAAATTTAGCTCGAGATCC
NM_001570.3       ACCGGGCTGCCCAGATCATCCTGAACTGGAAACCGGCTCCTGAAATCAGGTGTCCCATTC
                  * ** ** ** ***** ** ***************** ** ***** :.*    . ** *

HsCD00535950      GGCTGCTAACAAAGCCCGAAAGA-------------------------------------
NM_001570.3       CAGCCTTCCCTGACTCTGTGAAGCCAGAAAAGCCTTTGGCAGCTTCTGTAAGAAAGGCTG
                   .    *..*:.*  * *:.*..                                     

HsCD00535950      ------------------------------------------------------------
NM_001570.3       AGGATGAACAGGAAGAGGGGCAGCCTGTGAGGATGGCCACCTTTCCAGGCCCAGGGTCCT
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       CTCCAGCCAGAGCCCACCAGCCGGCCTTTCTCCAGCCTCCTGAAGAAGATGCCCCTCATT
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       CCTTGAGAAGCGACCTCCCCACTTCGTCTGATTCAAAGGACTTCAGCACCTCCATTCCTA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       AGCAGGAAAAACTTTTGAGCTTGGCTGGAGACAGCCTTTTCTGGAGTGAGGCAGACGTGG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       TCCAGGCAACCGATGACTTCAATCAAAACCGCAAAATCAGCCAGGGGACCTTTGCTGACG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       TCTACAGAGGGCACAGGCACGGGAAGCCATTCGTCTTCAAGAAGCTCAGAGAGACAGCCT
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GTTCAAGTCCAGGATCAATCGAAAGATTCTTCCAGGCAGAGTTGCAGATTTGTCTTAGAT
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GCTGCCACCCCAATGTCTTACCTGTGCTGGGCTTCTGTGCTGCAAGACAGTTTCACAGCT
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       TCATCTACCCCTACATGGCAAATGGTTCCCTACAGGACAGACTGCAGGGTCAGGGTGGCT
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       CGGACCCCCTCCCCTGGCCCCAGCGTGTCAGCATCTGCTCAGGGCTGCTCTGTGCCGTCG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       AGTACCTGCATGGTCTGGAGATCATCCACAGCAACGTCAAGAGCTCTAATGTCTTGCTGG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       ACCAAAATCTCACCCCCAAACTTGCTCACCCAATGGCTCATCTGTGTCCTGTCAACAAAA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GGTCAAAATACACCATGATGAAGACTCACCTGCTCCGGACGTCAGCCGCGTATCTGCCAG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       AGGATTTCATCCGGGTGGGGCAGCTGACAAAGCGAGTGGACATCTTCAGCTGTGGAATAG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       TGTTGGCCGAGGTCCTCACGGGCATCCCTGCAATGGATAACAACCGAAGCCCGGTTTACC
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       TGAAGGACTTACTCCTCAGTGATATTCCAAGCAGCACCGCCTCGCTCTGCTCCAGGAAGA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       CGGGCGTGGAGAACGTGATGGCAAAGGAGATCTGCCAGAAGTACCTGGAGAAGGGCGCAG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GGAGGCTTCCGGAGGACTGCGCCGAGGCCCTGGCCACGGCTGCCTGCCTGTGCCTGCGGA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GGCGTAACACCAGCCTGCAGGAGGTGTGTGGCTCTGTGGCTGCTGTGGAAGAGCGGCTCC
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GAGGTCGGGAGACGTTGCTCCCTTGGAGTGGGCTTTCTGAGGGTACAGGCTCTTCTTCCA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       ACACCCCAGAGGAAACAGACGACGTTGACAATTCCAGCCTTGATGCCTCCTCCTCCATGA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GTGTGGCACCCTGGGCAGGGGCTGCCACCCCACTTCTCCCCACAGAGAATGGGGAAGGAA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       GGCTGCGGGTCATCGTGGGAAGGGAGGCTGACTCCTCCTCTGAGGCCTGTGTTGGCCTGG
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       AGCCTCCCCAGGATGTTACAGAAACTTCGTGGCAAATTGAGATCAATGAGGCCAAAAGGA
                                                                              

HsCD00535950      ------------------------------------------------------------
NM_001570.3       AACTGATGGAGAATATTCTGCTCTACAAAGAGGAAAAAGTGGACAGCATTGAGCTCTTTG
                                                                              

HsCD00535950      --------
NM_001570.3       GCCCCTGA
                          

Pathways

NCI : Endogenous TLR signaling
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : IL-1 signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway

Protein

Structural Annotation Wiki : HR3068G
UniProt : O43187
HPRD : 04491

Clone

Cloning Information : 618439
HIP Master Clone ID : 515420
Original Clone ID : HR3068G-1-99-14.4

Experimental

TargetTrack - Experimental data : HR3068G

Organism


TAX_ID : 9606
Species Specific ID: 3656

Genome

Chromosome : 3
Map Location : 3p25.3
Ensembl : ENSG00000134070

Reagents

Labome : IRAK2-antibody