DNASU Plasmid Repository • 480.965.5697 | Email

D8L (Vaccinia virus WR) in pDONR222 (Gateway donor/master)

TOP

Explanation of Terms


Gene: Gene Symbol:  D8L
Gene Name:  IMV membrane protein
Sequence             
Original Clone ID: VV113A
Keyword: Carbonic anhydrase/Virion
Species: Vaccinia virus WR
Type: cDNA
Vector Name: pDONR222               Format:  FUSION
Source: University of Utah
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Utah
Leiliang Zhang
VvCD00543650

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 912nts         Open reading frame : 1 to 912

ATGCCGCAACAACTATCTCCTATTAATATAGAAACTAAAAAAGCAATTTCTAACGCGCGA
TTGAAGCCGTTAGACATACATTATAATGAGTCGAAACCAACCACTATCCAGAACACTGGA
AAACTAGTAAGGATTAATTTTAAAGGAGGATATATAAGTGGAGGGTTTCTCCCCAATGAA
TATGTGTTATCATCACTACATATATATTGGGGAAAGGAAGACGATTATGGATCCAATCAC
TTGATAGATGTGTACAAATACTCTGGAGAGATTAATCTTGTTCATTGGAATAAGAAAAAA
TATAGTTCTTATGAAGAGGCAAAAAAACACGATGATGGACTTATCATTATTTCTATATTC
TTACAAGTATTGGATCATAAAAATGTATATTTTCAAAAGATAGTTAATCAATTGGATTCC
ATTAGATCCGCCAATACGTCTGCACCGTTTGATTCAGTATTTTATCTAGACAATTTGCTG
CCTAGTAAGTTGGATTATTTTACATATCTAGGAACAACTATCAACCACTCTGCAGACGCT
GTATGGATAATTTTTCCAACGCCAATAAACATTCATTCTGATCAACTATCTAAATTCAGA
ACACTATTGTCGTCGTCTAATCATGATGGAAAACCGCATTATATAACAGAGAACTATAGA
AATCCGTATAAATTGAACGACGACACGCAAGTATATTATTCTGGGGAGATTATACGAGCA
GCAACTACCTCTCCAGCGCGCGAGAACTATTTTATGAGATGGTTGTCCGATTTGAGAGAG
ACATGTTTTTCATATTATCAAAAATATATCGAAGAGAATAAAACATTCGCAATTATTGCC
ATAGTATTCGTGTTTATACTTACCGCTATTCTCTTTTTTATGAGTCGACGATATTCGCGA
GAAAAACAAAAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR222

pDONR222 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  Unknown
Reverse:  Unknown
Description: Gateway entry vector; kanamycin resistance in bacterial; recombinational cloning
Comments: None
Size (bp): 4718
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC bacterial origin 4045 4718
death cassette ccdB ccdB death cassette gene (removed in plasmids containing a gene insert) 987 1292
primer M13 forward M13 forward sequencing primer 327 312
primer M13 reverse M13 reverse sequencing primer 2816 2832
recombination site attP1 attP1 recombinational cloning site 360 591
recombination site attP2 attP2 recombinational cloning site 2543 2774
selectable marker KanR kanamycin resistance gene 2899 3714
selectable marker CmR chloramphenicol resistance gene (removed in plasmids containing a gene insert) 1612 2295

 

  • Gene
  • Protein
  • Clone
  • Organism

Gene

 

Gene Symbol : D8L
GENEID : 3707569
Locus Tag : VACWR113
GenBank Accession : NC_006998.1
Locus Tag : VACWR113
Target GenBank: YP_232995

 

Protein

Protein GenBank Accession : YP_232995
SMART domain : Carb_anhydrase : Eukaryotic-type carbonic anhydrase

Clone

Cloning Information : 580492
Original Clone ID : VV113A

Organism


TAX_ID : 10245
Species Specific ID: 3707569