DNASU Plasmid Repository • 480.965.5697 | Email

LRRC71 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LRRC71
Gene Name:  leucine rich repeat containing 71
Sequence             
Original Clone ID: 5434.1.07_GO.34923
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
HsCD00546358

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1698nts         Open reading frame : 51 to 1748
Reference Sequence Alignment

ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
ACTTCCAGTCCTCGAGCGAGCAGAGCGCGCCGGGGGCCTCACCCAGGGCCCCGCGTCCGG
GGACCCAGAAGTCTTCTGGCGCGGTGACCAAAAAGGGAGAGCGCGCGGCCAAAGAGAAGC
CAGCGACCGTTCTGCCTCCCGTGGGGGAGGAGGAGCCCAAAAGCCCTGAGGAGTACCAGT
GCTCCGGGGTCCTCGAGACCGACTTCGCCGAGCTCTGCACGCGGTGGGGCTACACGGACT
TCCCCAAAGTTGTCAACCGGCCCCGCCCCCACCCGCCCTTCGTCCCCTCCGCCTCTTTGT
CGGAAAAGGCCACCTTAGACGATCCGCGGCTGTCGGGGTCCTGCAGCCTCAATAGCCTGG
AGAGCAAATACGTGTTCTTCCGGCCCACCATCCAGGTGGAGCTGGAGCAGGAGGACAGCA
AGTCAGTGAAGGAAATCTACATCCGCGGTTGGAAGGTTGAGGAACGGATTCTGGGTGTCT
TCTCTAAATGTCTGCCCCCGCTTACCCAGCTACAGGCCATCAACTTGTGGAAGGTGGGGC
TGACCGATAAGACCCTGACCACCTTCATCGAGCTCCTGCCTCTCTGTTCATCCACGCTCA
GGAAGGTGTCTCTGGAGGGGAACCCACTGCCGGAGCAGTCCTATCACAAGCTCATGGCCT
TGGACAGCACGATTGCGCACTTGTCTCTGCGGAACAATAACATCGACGACCGCGGGGCGC
AACTCCTGGGCCAGGCGCTGTCCACGCTGCACAGCTGCAACCGGACCCTCGTCTCGCTCA
ACCTGGGTTTCAACCACATCGGTGACGAGGGCGCAGGCTACATCGCGGACGGCCTCCGGC
TGAACCGTTCCCTGCTCTGGCTGTCCCTGGCCCACAACCGCATCCAGGACAAGGGCGCCC
TGAAGCTGGCTGAGGTCCTGCGCGCCTTCGAGCTGACACACACCGAAGTGGTGGAGCGCC
GACGCCTCCTGCTGGAAAAAGGGACACAGGAGCGCTCGCGATCGCCCTCCTCCTCTCGAC
ACGGGGACTCCAAAACGGACCGTGAGAAGAGTCAGATGGTAGGGATCAGCAATAGTGCAT
TGGTGGACAAGACAGACAAGACGCAGACAATGAAAACCCCTAAGGGCCTGGGCAAGAAAA
AGGAGAAATCATGGGAATTGGCCAAGAAAGAGGAGAAGTTGGGGTCTGGGCAGTCACCCA
CACAAGGAACCCCTAAGAAGGAAGATGCCACAAAGGCAGGCAAGGGGAAGGTAACCATCC
CTGAACAGAAGCCAAGCAGGGCAAAAGGGATCAAGATCGGGAGCAGAGAGAAGCGCAGCA
TCCTCCTGGAGTCCGAGCTGGTTGTTGAGGCTACTGAGGTGGTCAACCCTCTCCTGGAGC
CTGTGGAGCACCGAGATGGGAAAGTTTTCATGCCTGGGAACAAGGTCCTTTTGCACCTCA
ACCTCATCCGGAACCGCATCACAGAGGTGGGGCTGGAGGGCTTCCTCGCCACAGTGCAGT
ATCAGATGCAGTTCTCCAAGGCCAAGAGTGCATCCAAGGGTCCAGTGGGGCTGCTGTGGC
TGTCCCTGGCTAAAAATTGCTTCGCCCCACAATGTCCTGCGTACGCCATAATCCAGGAGC
TGATGTTGCCAAGGGATCCCATCAAGGCCAAACTCAGGGAGGATGAGGCCATGGCATTCT
TCCCCTAGTAGGACCCAGCTTTCTTGTA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAAGTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
GACCCAGCTTTCTTGTACAAAGTTGGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in GO.34923
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LRRC71
Symbol Nomenclature : LRRC71
SYNONYM : C1orf92; RP11-356J7.1
Designation : leucine-rich repeat-containing protein 71|leucine-rich repeat-containing protein C10orf92
Full Nomenclature : leucine rich repeat containing 71
GENEID : 149499
GI : 21708136
GenBank Accession : BC033790
HGNC : 26556
Vega : OTTHUMG00000041298
Target GenBank: BC033790

 

Reference Sequence Alignment

  

HsCD00546358        ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
NM_144702.2         ------------------------------------------------------------
XM_005244926.1      ------------------------------------------------------------
                                                                                

HsCD00546358        ACTTCCAGTCCTCGAGCGAGCAGAGCGCGCCGGGGGCCTCACCCAGGGCCCCGCGTCCGG
NM_144702.2         --------ATGTCGAGCGAGCAGAGCGCGCCGGGGGCCTCACCCAGGGCCCCGCGTCCGG
XM_005244926.1      --------ATGTCGAGCGAGCAGAGCGCGCCGGGGGCCTCACCCAGGGCCCCGCGTCCGG
                            :  *************************************************

HsCD00546358        GGACCCAGAAGTCTTCTGGCGCGGTGACCAAAAAGGGAGAGCGCGCGGCCAAAGAGAAGC
NM_144702.2         GGACCCAGAAGTCTTCTGGCGCGGTGACCAAAAAGGGAGAGCGCGCGGCCAAAGAGAAGC
XM_005244926.1      GGACCCAGAAGTCTTCTGGCGCGGTGACCAAAAAGGGAGAGCGCGCGGCCAAAGAGAAGC
                    ************************************************************

HsCD00546358        CAGCGACCGTTCTGCCTCCCGTGGGGGAGGAGGAGCCCAAAAGCCCTGAGGAGTACCAGT
NM_144702.2         CAGCGACCGTTCTGCCTCCCGTGGGGGAGGAGGAGCCCAAAAGCCCTGAGGAGTACCAGT
XM_005244926.1      CAGCGACCGTTCTGCCTCCCGTGGGGGAGGAGGAGCCCAAAAGCCCTGAGGAGTACCAGT
                    ************************************************************

HsCD00546358        GCTCCGGGGTCCTCGAGACCGACTTCGCCGAGCTCTGCACGCGGTGGGGCTACACGGACT
NM_144702.2         GCTCCGGGGTCCTCGAGACCGACTTCGCCGAGCTCTGCACGCGGTGGGGCTACACGGACT
XM_005244926.1      GCTCCGGGGTCCTCGAGACCGACTTCGCCGAGCTCTGCACGCGGTGGGGCTACACGGACT
                    ************************************************************

HsCD00546358        TCCCCAAAGTTGTCAACCGGCCCCGCCCCCACCCGCCCTTCGTCCCCTCCGCCTCTTTGT
NM_144702.2         TCCCCAAAGTTGTCAACCGGCCCCGCCCCCACCCGCCCTTCGTCCCCTCCGCCTCTTTGT
XM_005244926.1      TCCCCAAAGTTGTCAACCGGCCCCGCCCCCACCCGCCCTTCGTCCCCTCCGCCTCTTTGT
                    ************************************************************

HsCD00546358        CGGAAAAGGCCACCTTAGACGATCCGCGGCTGTCGGGGTCCTGCAGCCTCAATAGCCTGG
NM_144702.2         CGGAAAAGGCCACCTTAGACGATCCGCGGCTGTCGGGGTCCTGCAGCCTCAATAGCCTGG
XM_005244926.1      CGGAAAAGGCCACCTTAGACGATCCGCGGCTGTCGGGGTCCTGCAGCCTCAATAGCCTGG
                    ************************************************************

HsCD00546358        AGAGCAAATACGTGTTCTTCCGGCCCACCATCCAGGTGGAGCTGGAGCAGGAGGACAGCA
NM_144702.2         AGAGCAAATACGTGTTCTTCCGGCCCACCATCCAGGTGGAGCTGGAGCAGGAGGACAGCA
XM_005244926.1      AGAGCAAATACGTGTTCTTCCGGCCCACCATCCAGGTGGAGCTGGAGCAGGAGGACAGCA
                    ************************************************************

HsCD00546358        AGTCAGTGAAGGAAATCTACATCCGCGGTTGGAAGGTTGAGGAACGGATTCTGGGTGTCT
NM_144702.2         AGTCAGTGAAGGAAATCTACATCCGCGGTTGGAAGGTTGAGGAACGGATTCTGGGTGTCT
XM_005244926.1      AGTCAGTGAAGGAAATCTACATCCGCGGTTGGAAGGTTGAGGAACGGATTCTGGGTGTCT
                    ************************************************************

HsCD00546358        TCTCTAAATGTCTGCCCCCGCTTACCCAGCTACAGGCCATCAACTTGTGGAAGGTGGGGC
NM_144702.2         TCTCTAAATGTCTGCCCCCGCTTACCCAGCTACAGGCCATCAACTTGTGGAAGGTGGGGC
XM_005244926.1      TCTCTAAATGTCTGCCCCCGCTTACCCAGCTACAGGCCATCAACTTGTGGAAGGTGGGGC
                    ************************************************************

HsCD00546358        TGACCGATAAGACCCTGACCACCTTCATCGAGCTCCTGCCTCTCTGTTCATCCACGCTCA
NM_144702.2         TGACCGATAAGACCCTGACCACCTTCATCGAGCTCCTGCCTCTCTGTTCATCCACGCTCA
XM_005244926.1      TGACCGATAAGACCCTGACCACCTTCATCGAGCTCCTGCCTCTCTGTTCATCCACGCTCA
                    ************************************************************

HsCD00546358        GGAAGGTGTCTCTGGAGGGGAACCCACTGCCGGAGCAGTCCTATCACAAGCTCATGGCCT
NM_144702.2         GGAAGGTGTCTCTGGAGGGGAACCCACTGCCGGAGCAGTCCTATCACAAGCTCATGGCCT
XM_005244926.1      GGAAGGTGTCTCTGGAGGGGAACCCACTGCCGGAGCAGTCCTATCACAAGCTCATGGCCT
                    ************************************************************

HsCD00546358        TGGACAGCACGATTGCGCACTTGTCTCTGCGGAACAATAACATCGACGACCGCGGGGCGC
NM_144702.2         TGGACAGCACGATTGCGCACTTGTCTCTGCGGAACAATAACATCGACGACCGCGGGGCGC
XM_005244926.1      TGGACAGCACGATTGCGCACTTGTCTCTGCGGAACAATAACATCGACGACCGCGGGGCGC
                    ************************************************************

HsCD00546358        AACTCCTGGGCCAGGCGCTGTCCACGCTGCACAGCTGCAACCGGACCCTCGTCTCGCTCA
NM_144702.2         AACTCCTGGGCCAGGCGCTGTCCACGCTGCACAGCTGCAACCGGACCCTCGTCTCGCTCA
XM_005244926.1      AACTCCTGGGCCAGGCGCTGTCCACGCTGCACAGCTGCAACCGGACCCTCGTCTCGCTCA
                    ************************************************************

HsCD00546358        ACCTGGGTTTCAACCACATCGGTGACGAGGGCGCAGGCTACATCGCGGACGGCCTCCGGC
NM_144702.2         ACCTGGGTTTCAACCACATCGGTGACGAGGGCGCAGGCTACATCGCGGACGGCCTCCGGC
XM_005244926.1      ACCTGGGTTTCAACCACATCGGTGACGAGGGCGCAGGCTACATCGCGGACGGCCTCCGGC
                    ************************************************************

HsCD00546358        TGAACCGTTCCCTGCTCTGGCTGTCCCTGGCCCACAACCGCATCCAGGACAAGGGCGCCC
NM_144702.2         TGAACCGTTCCCTGCTCTGGCTGTCCCTGGCCCACAACCGCATCCAGGACAAGGGCGCCC
XM_005244926.1      TGAACCGTTCCCTGCTCTGGCTGTCCCTGGCCCACAACCGCATCCAGGACAAGGGCGCCC
                    ************************************************************

HsCD00546358        TGAAGCTGGCTGAGGTCCTGCGCGCCTTCGAGCTGACACACACCGAAGTGGTGGAGCGCC
NM_144702.2         TGAAGCTGGCTGAGGTCCTGCGCGCCTTCGAGCTGACACACACCGAAGTGGTGGAGCGCC
XM_005244926.1      TGAAGCTGGCTGAGGTCCTGCGCGCCTTCGAGCTGACACACACCGAAGTGGTGGAGCGCC
                    ************************************************************

HsCD00546358        GACGCCTCCTGCTGGAAAAAGGGACACAGGAGCGCTCGCGATCGCCCTCCTCCTCTCGAC
NM_144702.2         GACGCCTCCTGCTGGAAAAAGGGACACAGGAGCGCTCGCGATCGCCCTCCTCCTCTCGAC
XM_005244926.1      GACGCCTCCTGCTGGAAAAAGGGACACAGGAGCGCTCGCGATCGCCCTCCTCCTCTCGAC
                    ************************************************************

HsCD00546358        ACGGGGACTCCAAAACGGACCGTGAGAAGAGTCAGATGGTAGGGATCAGCAATAGTGCAT
NM_144702.2         ACGGGGACTCCAAAACGGACCGTGAGAAGAGTCAGATGGTAGGGATCAGCAATAGTGCAT
XM_005244926.1      ACGGGGACTCCAAAACGGACCGTGAGAAGAGTCAGATGGTAGGGATCAGCAATAGTGCAT
                    ************************************************************

HsCD00546358        TGGTGGACAAGACAGACAAGACGCAGACAATGAAAACCCCTAAGGGCCTGGGCAAGAAAA
NM_144702.2         TGGTGGACAAGACAGACAAGACGCAGACAATGAAAACCCCTAAGGGCCTGGGCAAGAAAA
XM_005244926.1      TGGTGGACAAGACAGACAAGACGCAGACAATGAAAACCCCTAAGGGCCTGGGCAAGAAAA
                    ************************************************************

HsCD00546358        AGGAGAAATCATGGGAATTGGCCAAGAAAGAGGAGAAGTTGGGGTCTGGGCAGTCACCCA
NM_144702.2         AGGAGAAATCATGGGAATTGGCCAAGAAAGAGGAGAAGTTGGGGTCTGGGCAGTCACCCA
XM_005244926.1      AGGAGAAATCATGGGAATTGGCCAAGAAAGAGGAGAAGTTGGGGTCTGGGCAGTCACCCA
                    ************************************************************

HsCD00546358        CACAAGGAACCCCTAAGAAGGAAGATGCCACAAAGGCAGGCAAGGGGAAGGTAACCATCC
NM_144702.2         CACAAGGAACCCCTAAGAAGGAAGATGCCACAAAGGCAGGCAAGGGGAAGGTAACCATCC
XM_005244926.1      CACAAGGAACCCCTAAGAAGGAAGATGCCACAAAGGCAGGCAAGGGGAAGGTAACCATCC
                    ************************************************************

HsCD00546358        CTGAACAGAAGCCAAGCAGGGCAAAAGGGATCAAGATCGGGAGCAGAGAGAAGCGCAGCA
NM_144702.2         CTGAACAGAAGCCAAGCAGGGCAAAAGGGATCAAGATCGGGAGCAGAGAGAAGCGCAGCA
XM_005244926.1      CTGAACAGAAGCCAAGCAGGGCAAAAGGGATCAAGATCGGGAGCAGAGAGAAGCGCAGCA
                    ************************************************************

HsCD00546358        TCCTCCTGGAGTCCGAGCTGGTTGTTGAG---GCTACTGAGGTGGTCAACCCTCTCCTGG
NM_144702.2         TCCTCCTGGAGTCCGAGCTGGTTGTTGAG---GCTACTGAGGTGGTCAACCCTCTCCTGG
XM_005244926.1      TCCTCCTGGAGTCCGAGCAGCTGGTTGTTGAGGCTACTGAGGTGGTCAACCCTCTCCTGG
                    ******************:* * ****:    ****************************

HsCD00546358        AGCCTGTGGAGCACCGAGATGGGAAAGTTTTCATGCCTGGGAACAAGGTCCTTTTGCACC
NM_144702.2         AGCCTGTGGAGCACCGAGATGGGAAAGTTTTCATGCCTGGGAACAAGGTCCTTTTGCACC
XM_005244926.1      AGCCTGTGGAGCACCGAGATGGGAAAGTTTTCATGCCTGGGAACAAGGTCCTTTTGCACC
                    ************************************************************

HsCD00546358        TCAACCTCATCCGGAACCGCATCACAGAGGTGGGGCTGGAGGGCTTCCTCGCCACAGTGC
NM_144702.2         TCAACCTCATCCGGAACCGCATCACAGAGGTGGGGCTGGAGGGCTTCCTCGCCACGGTGC
XM_005244926.1      TCAACCTCATCCGGAACCGCATCACAGAGGTGGGGCTGGAGGGCTTCCTCGCCACGGTGC
                    *******************************************************.****

HsCD00546358        AGTATCAGATGCAGTTCTCCAAGGCCAAGAGTGCATCCAAGGGTCCAGTGGGGCTGCTGT
NM_144702.2         AGTATCAGATGCAGTTCTCCAAGGCCAAGAGTGCATCCAAGGGTCCAGTGGGGCTGCTGT
XM_005244926.1      AGTATCAGATGCAGTTCTCCAAGGCCAAGAGTGCATCCAAGGGTCCAGTGGGGCTGCTGT
                    ************************************************************

HsCD00546358        GGCTGTCCCTGGCTAAAAATTGCTTCGCCCCACAATGTCCTGCGTACGCCATAATCCAGG
NM_144702.2         GGCTGTCCCTGGCTAAAAATTGCTTCGCCCCACAATGTCCTGCGTACGCCATAATCCAGG
XM_005244926.1      GGCTGTCCCTGGCTAAAAATTGCTTCGCCCCACAATGTCCTGCGTACGCCATAATCCAGG
                    ************************************************************

HsCD00546358        AGCTGATGTTGCCAAGGGATCCCATCAAGGCCAAACTCAGGGAGGATGAGGCCATGGCAT
NM_144702.2         AGCTGATGTTGCCAAGGGATCCCATCAAGGCCAAACTCAGGGAGGATGAGGCCATGGCAT
XM_005244926.1      AGCTGATGTTGCCAAGGGATCCCATCAAGGCCAAACTCAGGGAGGATGAGGCCATGGCAT
                    ************************************************************

HsCD00546358        TCTTCCCCTAGTAGGACCCAGCTTTCTTGTA
NM_144702.2         TCTTCCCCTAG--------------------
XM_005244926.1      TCTTCCCCTAG--------------------
                    ***********                    

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
Structural Annotation Wiki : GO.34923
HPRD : 08737

Clone

Cloning Information : 502894
HIP Master Clone ID : 414061
Original Clone ID : 5434.1.07_GO.34923

Experimental

TargetTrack - Experimental data : GO.34923

Organism


TAX_ID : 9606
Species Specific ID: 149499

Genome

Chromosome : 1
Map Location : 1q23.1
Ensembl : ENSG00000160838

Reagents

Labome : LRRC71-antibody