DNASU Plasmid Repository • 480.965.5697 | Email

RRAS (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RRAS
Gene Name:  related RAS viral (r-ras) oncogene homolog
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131303.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00005566

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 657nts         Open reading frame : 1 to 657
Reference Sequence Alignment

ATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGGG
CCCGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTG
GGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCC
ACTATTGAGGACTCCTACACGAAGATCTGCAGTGTGGATGGCATCCCAGCCCGGCTGGAC
ATCCTGGACACCGCGGGCCAGGAAGAGTTCGGGGCCATGAGAGAGCAGTACATGCGTGCT
GGCCACGGCTTCCTGCTGGTGTTCGCCATTAATGACCGGCAGAGTTTCAACGAGGTGGGC
AAGCTCTTCACGCAGATTCTGCGGGTCAAGGACCGCGACGACTTCCCCGTTGTGTTGGTC
GGGAACAAGGCAGATCTGGAGTCACAGCGCCAGGTCCCCCGATCAGAAGCCTCTGCCTTC
GGCGCCTCCCACCACGTGGCCTACTTTGAGGCCTCGGCCAAACTGCGTCTCAACGTGGAC
GAGGCTTTTGAGCAGCTGGTGCGGGCTGTCCGGAAATACCAGGAACAAGAGCTCCCACCG
AGCCCTCCCAGTGCCCCCAGGAAGAAGGGCGGGGGCTGCCCCTGCGTCCTCCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 657
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RRAS
Symbol Nomenclature : RRAS
Designation : Oncogene RRAS|p23|ras-related protein R-Ras
Full Nomenclature : related RAS viral (r-ras) oncogene homolog
GENEID : 6237
GI : 60823711
GenBank Accession : AY893616
HGNC : 10447
MIM : 165090
Vega : OTTHUMG00000183247
Target GenBank: AF493920

 

Reference Sequence Alignment

  

HsCD00005566      ATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGGG
NM_006270.3       ATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGGG
                  ************************************************************

HsCD00005566      CCCGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTG
NM_006270.3       CCCGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTG
                  ************************************************************

HsCD00005566      GGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCC
NM_006270.3       GGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCC
                  ************************************************************

HsCD00005566      ACTATTGAGGACTCCTACACGAAGATCTGCAGTGTGGATGGCATCCCAGCCCGGCTGGAC
NM_006270.3       ACTATTGAGGACTCCTACACGAAGATCTGCAGTGTGGATGGCATCCCAGCCCGGCTGGAC
                  ************************************************************

HsCD00005566      ATCCTGGACACCGCGGGCCAGGAAGAGTTCGGGGCCATGAGAGAGCAGTACATGCGTGCT
NM_006270.3       ATCCTGGACACCGCGGGCCAGGAAGAGTTCGGGGCCATGAGAGAGCAGTACATGCGTGCT
                  ************************************************************

HsCD00005566      GGCCACGGCTTCCTGCTGGTGTTCGCCATTAATGACCGGCAGAGTTTCAACGAGGTGGGC
NM_006270.3       GGCCACGGCTTCCTGCTGGTGTTCGCCATTAACGACCGGCAGAGTTTCAACGAGGTGGGC
                  ******************************** ***************************

HsCD00005566      AAGCTCTTCACGCAGATTCTGCGGGTCAAGGACCGCGACGACTTCCCCGTTGTGTTGGTC
NM_006270.3       AAGCTCTTCACGCAGATTCTGCGGGTCAAGGACCGCGACGACTTCCCCGTTGTGTTGGTC
                  ************************************************************

HsCD00005566      GGGAACAAGGCAGATCTGGAGTCACAGCGCCAGGTCCCCCGATCAGAAGCCTCTGCCTTC
NM_006270.3       GGGAACAAGGCAGATCTGGAGTCACAGCGCCAGGTCCCCCGATCAGAAGCCTCTGCCTTC
                  ************************************************************

HsCD00005566      GGCGCCTCCCACCACGTGGCCTACTTTGAGGCCTCGGCCAAACTGCGTCTCAACGTGGAC
NM_006270.3       GGCGCCTCCCACCACGTGGCCTACTTTGAGGCCTCGGCCAAACTGCGTCTCAACGTGGAC
                  ************************************************************

HsCD00005566      GAGGCTTTTGAGCAGCTGGTGCGGGCTGTCCGGAAATACCAGGAACAAGAGCTCCCACCG
NM_006270.3       GAGGCTTTTGAGCAGCTGGTGCGGGCTGTCCGGAAATACCAGGAACAAGAGCTCCCACCG
                  ************************************************************

HsCD00005566      AGCCCTCCCAGTGCCCCCAGGAAGAAGGGCGGGGGCTGCCCCTGCGTCCTCCTGTAG
NM_006270.3       AGCCCTCCCAGTGCCCCCAGGAAGAAGGGCGGGGGCTGCCCCTGCGTCCTCCTGTAG
                  *********************************************************

Pathways

NCI : EPHB forward signaling
NCI : Plexin-D1 Signaling
NCI : Regulation of Ras family activation
NCI : Signaling events mediated by focal adhesion kinase
Panther : EGF receptor signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : TGF-beta signaling pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Developmental Biology
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : SEMA3A-Plexin repulsion signaling by inhibiting Integrin adhesion
Reactome : Sema4D in semaphorin signaling
Reactome : Sema4D mediated inhibition of cell attachment and migration
Reactome : Semaphorin interactions
Reactome : Transmission across Chemical Synapses
WikiPathway : G Protein Signaling Pathways
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MAPK Cascade
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 131303
HIP Master Clone ID : 107460
Original Clone ID : FLH131303.01X

Organism


TAX_ID : 9606
Species Specific ID: 6237

Genome

Chromosome : 19
Map Location : 19q13.33
Ensembl : ENSG00000126458

Reagents

Labome : RRAS-antibody