DNASU Plasmid Repository • 480.965.5697 | Email

HCK (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  HCK
Gene Name:  hemopoietic cell kinase
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127845.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1518nts         Open reading frame : 1 to 1518
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1686
Start on reference sequence 169
a150g; c1476t

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : HCK
Symbol Nomenclature : HCK
SYNONYM : JTK9; p59Hck; p61Hck
Designation : hematopoietic cell kinase|p59-HCK/p60-HCK|tyrosine-protein kinase HCK
Full Nomenclature : hemopoietic cell kinase
GENEID : 3055
Locus Tag : RP5-836N17.3
GI : 60824197
GenBank Accession : AY893634
HGNC : 4840
MIM : 142370
Vega : OTTHUMG00000032204
Target GenBank: M16591


Reference Sequence Alignment


HsCD00005821        ------------------------------------------------------------
NM_001172129.1      ------------------------------------------------------------
NM_001172132.1      ------------------------------------------------------------
NM_001172133.1      ------------------------------------------------------------
NM_001172131.1      ------------------------------------------------------------

                       *******  ************************************************


                    ********************************.*********         *********






















                    ***************************************** ******************



NCI : Alpha-synuclein signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EPHA forward signaling
NCI : Ephrin B reverse signaling
NCI : Glypican 1 network
NCI : IL6-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Parkinson disease
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : FCGR activation
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Nef and signal transduction
Reactome : Regulation of signaling by CBL
Reactome : Signaling by Interleukins
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
WikiPathway : Focal Adhesion
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-6 signaling pathway


Cloning Information : 127845
HIP Master Clone ID : 103994
Original Clone ID : FLH127845.01X


TAX_ID : 9606
Species Specific ID: 3055


Chromosome : 20
Map Location : 20q11-q12
Ensembl : ENSG00000101336


Labome : HCK-antibody